EMAIL THIS PAGE TO A FRIEND

CHST5

carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5

68 Gene Product Result for
Synonyms: I-GlcNAc-6-ST I-GlcNAc6ST glcNAc6ST-3 gn6st-3 hIGn6ST
UniProtKB ID: Q9GZS9, B2RV23, Q7LCN3, Q9UBY3
Gene ID:
Human(23563) Summary: The protein encoded by this gene belongs to the Gal/GalNAc/GlcNAc 6-O-sulfotransferase (GST) family, members of which catalyze the transfer of sulfate to position 6 of galactose (Gal), N-acetylgalactosamine (GalNAc), or N-acetylglucosamine (GlcNAc) residues within proteoglycans, and sulfation of O-linked sugars of mucin-type acceptors. Carbohydrate sulfation plays a critical role in many biologic processes. This gene is predominantly expressed in colon and small intestine. [provided by RefSeq, Aug 2011]
Mouse(56773) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
Rat(307859) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019950 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019950 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019950 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012126 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012126 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012126 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012126 Rosetta Predictions human pricing
NM_024533 Rosetta Predictions human pricing
NM_001107431 Rosetta Predictions rat pricing
NM_019950 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012126 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213393 predicted 623
2 SASI_Hs01_00213394 predicted 685
3 SASI_Hs01_00213395 predicted 1215
4 SASI_Hs01_00213396 predicted 996
5 SASI_Hs01_00213397 predicted 1286
6 SASI_Hs01_00213398 predicted 804
7 SASI_Hs01_00213399 predicted 1186
8 SASI_Hs01_00213400 predicted 778
9 SASI_Hs01_00213401 predicted 631
10 SASI_Hs01_00213402 predicted 691
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194593 predicted 1738
2 SASI_Hs01_00194594 predicted 1801
3 SASI_Hs01_00194596 predicted 2106
4 SASI_Hs01_00194597 predicted 2398
5 SASI_Hs01_00194598 predicted 1908
6 SASI_Hs01_00194599 predicted 2305
7 SASI_Hs01_00194600 predicted 1887
8 SASI_Hs01_00194601 predicted 1741
9 SASI_Hs01_00194602 predicted 1797
10 SASI_Hs02_00356826 predicted 2395
11 SASI_Hs01_00194595 predicted 2325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228755 predicted 1362
2 SASI_Rn02_00228756 predicted 1380
3 SASI_Rn02_00228757 predicted 500
4 SASI_Rn02_00228758 predicted 1604
5 SASI_Rn02_00228759 predicted 1007
6 SASI_Rn02_00228760 predicted 344
7 SASI_Rn02_00228761 predicted 387
8 SASI_Rn02_00228762 predicted 1475
9 SASI_Rn02_00228763 predicted 1025
10 SASI_Rn02_00228764 predicted 1371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019950 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325247 predicted 1397
2 SASI_Mm01_00125077 predicted 1470
3 SASI_Mm01_00125078 predicted 926
4 SASI_Mm01_00125079 predicted 307
5 SASI_Mm01_00125080 predicted 1529
6 SASI_Mm01_00125081 predicted 1466
7 SASI_Mm01_00125082 predicted 1360
8 SASI_Mm01_00125083 predicted 417
9 SASI_Mm01_00125084 predicted 824
10 SASI_Mm01_00125085 predicted 358
11 SASI_Mm01_00125086 predicted 629
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019950
CHST5 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019950.1-1315s1c1
Sequence:CCGGGCTATAACATTAGGGTCTATTCTCGAGAATAGACCCTAATGTTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-1003s1c1
Sequence:CCGGCCAGACTTGGATCCACAATATCTCGAGATATTGTGGATCCAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-634s1c1
Sequence:CCGGGCGCTTCTTTAACCTACAGGTCTCGAGACCTGTAGGTTAAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-407s1c1
Sequence:CCGGCTATGCGACATGGACGTATTTCTCGAGAAATACGTCCATGTCGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-406s1c1
Sequence:CCGGCCTATGCGACATGGACGTATTCTCGAGAATACGTCCATGTCGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019950
CHST5 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019950.1-1315s1c1
Sequence:CCGGGCTATAACATTAGGGTCTATTCTCGAGAATAGACCCTAATGTTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-1003s1c1
Sequence:CCGGCCAGACTTGGATCCACAATATCTCGAGATATTGTGGATCCAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-634s1c1
Sequence:CCGGGCGCTTCTTTAACCTACAGGTCTCGAGACCTGTAGGTTAAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-407s1c1
Sequence:CCGGCTATGCGACATGGACGTATTTCTCGAGAAATACGTCCATGTCGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-406s1c1
Sequence:CCGGCCTATGCGACATGGACGTATTCTCGAGAATACGTCCATGTCGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019950
CHST5 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019950.1-1315s1c1
Sequence:CCGGGCTATAACATTAGGGTCTATTCTCGAGAATAGACCCTAATGTTATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-1003s1c1
Sequence:CCGGCCAGACTTGGATCCACAATATCTCGAGATATTGTGGATCCAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103213    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-634s1c1
Sequence:CCGGGCGCTTCTTTAACCTACAGGTCTCGAGACCTGTAGGTTAAAGAAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103212    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-407s1c1
Sequence:CCGGCTATGCGACATGGACGTATTTCTCGAGAAATACGTCCATGTCGCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019950.1-406s1c1
Sequence:CCGGCCTATGCGACATGGACGTATTCTCGAGAATACGTCCATGTCGCATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012126
CHST5 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-1354s1c1
Sequence:CCGGGTTGCCCTTCACTAAGATCCTCTCGAGAGGATCTTAGTGAAGGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-771s1c1
Sequence:CCGGCCATCAGCAAGCAGGACGTATCTCGAGATACGTCCTGCTTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-625s1c1
Sequence:CCGGCGACCTGATGCGCTCTATCTTCTCGAGAAGATAGAGCGCATCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-1299s1c1
Sequence:CCGGCCTTCCATACTTCGTCTAGGACTCGAGTCCTAGACGAAGTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-686s1c1
Sequence:CCGGAGCCGAAACCTGTCCGCCTTTCTCGAGAAAGGCGGACAGGTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012126
CHST5 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-1354s1c1
Sequence:CCGGGTTGCCCTTCACTAAGATCCTCTCGAGAGGATCTTAGTGAAGGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-771s1c1
Sequence:CCGGCCATCAGCAAGCAGGACGTATCTCGAGATACGTCCTGCTTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-625s1c1
Sequence:CCGGCGACCTGATGCGCTCTATCTTCTCGAGAAGATAGAGCGCATCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-1299s1c1
Sequence:CCGGCCTTCCATACTTCGTCTAGGACTCGAGTCCTAGACGAAGTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-686s1c1
Sequence:CCGGAGCCGAAACCTGTCCGCCTTTCTCGAGAAAGGCGGACAGGTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012126
CHST5 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-1354s1c1
Sequence:CCGGGTTGCCCTTCACTAAGATCCTCTCGAGAGGATCTTAGTGAAGGGCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-771s1c1
Sequence:CCGGCCATCAGCAAGCAGGACGTATCTCGAGATACGTCCTGCTTGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-625s1c1
Sequence:CCGGCGACCTGATGCGCTCTATCTTCTCGAGAAGATAGAGCGCATCAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034899    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-1299s1c1
Sequence:CCGGCCTTCCATACTTCGTCTAGGACTCGAGTCCTAGACGAAGTATGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012126.1-686s1c1
Sequence:CCGGAGCCGAAACCTGTCCGCCTTTCTCGAGAAAGGCGGACAGGTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks