EMAIL THIS PAGE TO A FRIEND

CHST6

carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6

78 Gene Product Result for
Synonyms: MCDC1
UniProtKB ID: Q9GZX3, D3DUK3
Gene ID:
Human(4166) Summary: The protein encoded by this gene is an enzyme that catalyzes the transfer of a sulfate group to the GlcNAc residues of keratan. Keratan sulfate helps maintain corneal transparency. Defects in this gene are a cause of macular corneal dystrophy (MCD). [provided by RefSeq, Jan 2010]
chicken(770257) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5
cow(538464) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6
dog(489707) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6
naked mole-rat(101707433) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6
domestic guinea pig(100713202) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6
sheep(101118212) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2100428 Anti-CHST6 (ab1) antibody produced in rabbit affinity isolated antibody bovine, human, guinea pig, horse
western blot pricing
SAB2100429 Anti-CHST6 (ab2) antibody produced in rabbit affinity isolated antibody canine, rat, mouse, bovine, human, horse
western blot pricing
SAB4501842 Anti-CHST6, C-Terminal antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021615 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021615 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021615 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042621 MISSION® esiRNA esiRNA human CHST6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021615 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021615 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246667 predicted 1772
2 SASI_Hs01_00246668 predicted 1818
3 SASI_Hs01_00246669 predicted 1439
4 SASI_Hs01_00246670 predicted 1131
5 SASI_Hs01_00246671 predicted 1321
6 SASI_Hs01_00246672 predicted 1352
7 SASI_Hs01_00246673 predicted 1145
8 SASI_Hs01_00246674 predicted 1678
9 SASI_Hs01_00246675 predicted 537
10 SASI_Hs02_00354949 predicted 1463
11 SASI_Hs01_00246666 predicted 1827
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021615
CHST6 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000036164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-1098s1c1
Sequence:CCGGCATAACATCACCCACGGATCTCTCGAGAGATCCGTGGGTGATGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-530s1c1
Sequence:CCGGCCGCAACCTGTCCGACCTCTTCTCGAGAAGAGGTCGGACAGGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-1028s1c1
Sequence:CCGGGCTGGCAGAAATCCGTGCGCTCTCGAGAGCGCACGGATTTCTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-504s1c1
Sequence:CCGGGTGTTTGATGCCTATCTGCCTCTCGAGAGGCAGATAGGCATCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021615
CHST6 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000036164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-1098s1c1
Sequence:CCGGCATAACATCACCCACGGATCTCTCGAGAGATCCGTGGGTGATGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-530s1c1
Sequence:CCGGCCGCAACCTGTCCGACCTCTTCTCGAGAAGAGGTCGGACAGGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-1028s1c1
Sequence:CCGGGCTGGCAGAAATCCGTGCGCTCTCGAGAGCGCACGGATTTCTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-504s1c1
Sequence:CCGGGTGTTTGATGCCTATCTGCCTCTCGAGAGGCAGATAGGCATCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021615
CHST6 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 6
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000036164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-1098s1c1
Sequence:CCGGCATAACATCACCCACGGATCTCTCGAGAGATCCGTGGGTGATGTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036165    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-530s1c1
Sequence:CCGGCCGCAACCTGTCCGACCTCTTCTCGAGAAGAGGTCGGACAGGTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-1028s1c1
Sequence:CCGGGCTGGCAGAAATCCGTGCGCTCTCGAGAGCGCACGGATTTCTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021615.2-504s1c1
Sequence:CCGGGTGTTTGATGCCTATCTGCCTCTCGAGAGGCAGATAGGCATCAAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks