EMAIL THIS PAGE TO A FRIEND

CHST7

carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7

51 Gene Product Result for
Synonyms: C6ST-2 GST-5
UniProtKB ID: Q9NS84, O75667
Gene ID:
Human(56548) Summary: This gene belongs to the sulfotransferase gene family. Sulfotransferases generate sulfated glycosaminoglycan (GAG) moities during chondroitin sulfate biosynthesis. They create considerable structural diversity among chondroitin sulfates by transferring sulfate with remarkable specificity for the underlying oligosaccharide substrate. This gene product mainly transfers sulfate to N-acetylgalactosamine. The regulated expression of each member of this gene family may be an important determinant of sulfated GAGs expression and the associated function of chondroitin sulfates as regulators of many biologic processes. This gene is part of a gene cluster on chromosome Xp11.23. [provided by RefSeq, Jul 2008]
Mouse(60322) carbohydrate (N-acetylglucosamino) sulfotransferase 7
Rat(302302) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
sheep(101119189) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
Domestic Rabbit(100338181) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
domestic guinea pig(100713244) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
dog(491852) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
cow(540357) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
domestic cat(101089584) carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019886 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019886 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019886 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021715 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021715 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021715 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU041931 MISSION® esiRNA esiRNA targeting mouse Chst7 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019886 Rosetta Predictions human pricing
NM_207600 Rosetta Predictions rat pricing
NM_021715 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019886 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170115 predicted 1782
2 SASI_Hs01_00170116 predicted 1797
3 SASI_Hs01_00170117 predicted 1788
4 SASI_Hs01_00170118 predicted 1832
5 SASI_Hs01_00170119 predicted 1827
6 SASI_Hs01_00170120 predicted 403
7 SASI_Hs01_00170121 predicted 1734
8 SASI_Hs01_00170122 predicted 410
9 SASI_Hs01_00170123 predicted 1765
10 SASI_Hs02_00352898 predicted 1650
11 SASI_Hs01_00170124 predicted 222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207600 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108326 predicted 1592
2 SASI_Rn02_00270419 predicted 1967
3 SASI_Rn01_00108327 predicted 770
4 SASI_Rn02_00270420 predicted 1879
5 SASI_Rn01_00108328 predicted 1687
6 SASI_Rn02_00270421 predicted 1979
7 SASI_Rn02_00270422 predicted 1911
8 SASI_Rn01_00108329 predicted 1305
9 SASI_Rn02_00270423 predicted 1988
10 SASI_Rn01_00108331 predicted 824
11 SASI_Rn01_00108330 predicted 1768
12 SASI_Rn01_00108332 predicted 457
13 SASI_Rn01_00108333 predicted 1870
14 SASI_Rn01_00108334 predicted 1865
15 SASI_Rn01_00108335 predicted 1506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021715 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115605 predicted 1580
2 SASI_Mm01_00115606 predicted 1877
3 SASI_Mm01_00115607 predicted 1823
4 SASI_Mm01_00115608 predicted 1778
5 SASI_Mm01_00115609 predicted 1942
6 SASI_Mm01_00115610 predicted 861
7 SASI_Mm01_00115611 predicted 1588
8 SASI_Mm01_00115612 predicted 803
9 SASI_Mm01_00115613 predicted 1843
10 SASI_Mm01_00115614 predicted 1839
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019886
VALIDATED
CHST7 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019886.2-1378s1c1
Sequence:CCGGCGATGCCTTCGCGCTCAACATCTCGAGATGTTGAGCGCGAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019886.2-1184s1c1
Sequence:CCGGGCCGATTTCTTCCTGACCGGTCTCGAGACCGGTCAGGAAGAAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019886.2-757s1c1
Sequence:CCGGCTGGCGGACTAACAAGGTCATCTCGAGATGACCTTGTTAGTCCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_019886.2-566s1c1
Sequence:CCGGTATGAGCCCATGTGGCATCTACTCGAGTAGATGCCACATGGGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019886.2-219s1c1
Sequence:CCGGCGCTGCTGTTGGTGCTGTACACTCGAGTGTACAGCACCAACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-469s21c1
Sequence:CCGGTCGCGAGAAGCAGCACATCTACTCGAGTAGATGTGCTGCTTCTCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_019886.2-520s21c1
Sequence:CCGGCTTCCTGGGCGAACTCTTTAACTCGAGTTAAAGAGTTCGCCCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019886.2-2095s21c1
Sequence:CCGGTAATAGGTCTGGGCAGTATTGCTCGAGCAATACTGCCCAGACCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-970s21c1
Sequence:CCGGTGATCCAGGCCTCAACCTGAACTCGAGTTCAGGTTGAGGCCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-757s21c1
Sequence:CCGGCTGGCGGACTAACAAGGTCATCTCGAGATGACCTTGTTAGTCCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-1378s21c1
Sequence:CCGGCGATGCCTTCGCGCTCAACATCTCGAGATGTTGAGCGCGAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019886.2-1871s21c1
Sequence:CCGGACAGTGCAATGTGGATATTTACTCGAGTAAATATCCACATTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-1282s21c1
Sequence:CCGGCTACCTGAGGCTGCGCTATGACTCGAGTCATAGCGCAGCCTCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019886
VALIDATED
CHST7 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019886.2-1378s1c1
Sequence:CCGGCGATGCCTTCGCGCTCAACATCTCGAGATGTTGAGCGCGAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019886.2-1184s1c1
Sequence:CCGGGCCGATTTCTTCCTGACCGGTCTCGAGACCGGTCAGGAAGAAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019886.2-757s1c1
Sequence:CCGGCTGGCGGACTAACAAGGTCATCTCGAGATGACCTTGTTAGTCCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_019886.2-566s1c1
Sequence:CCGGTATGAGCCCATGTGGCATCTACTCGAGTAGATGCCACATGGGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019886.2-219s1c1
Sequence:CCGGCGCTGCTGTTGGTGCTGTACACTCGAGTGTACAGCACCAACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-469s21c1
Sequence:CCGGTCGCGAGAAGCAGCACATCTACTCGAGTAGATGTGCTGCTTCTCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_019886.2-520s21c1
Sequence:CCGGCTTCCTGGGCGAACTCTTTAACTCGAGTTAAAGAGTTCGCCCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019886.2-2095s21c1
Sequence:CCGGTAATAGGTCTGGGCAGTATTGCTCGAGCAATACTGCCCAGACCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-970s21c1
Sequence:CCGGTGATCCAGGCCTCAACCTGAACTCGAGTTCAGGTTGAGGCCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-757s21c1
Sequence:CCGGCTGGCGGACTAACAAGGTCATCTCGAGATGACCTTGTTAGTCCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-1378s21c1
Sequence:CCGGCGATGCCTTCGCGCTCAACATCTCGAGATGTTGAGCGCGAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019886.2-1871s21c1
Sequence:CCGGACAGTGCAATGTGGATATTTACTCGAGTAAATATCCACATTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-1282s21c1
Sequence:CCGGCTACCTGAGGCTGCGCTATGACTCGAGTCATAGCGCAGCCTCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019886
VALIDATED
CHST7 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_019886.2-1378s1c1
Sequence:CCGGCGATGCCTTCGCGCTCAACATCTCGAGATGTTGAGCGCGAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035041    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019886.2-1184s1c1
Sequence:CCGGGCCGATTTCTTCCTGACCGGTCTCGAGACCGGTCAGGAAGAAATCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019886.2-757s1c1
Sequence:CCGGCTGGCGGACTAACAAGGTCATCTCGAGATGACCTTGTTAGTCCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_019886.2-566s1c1
Sequence:CCGGTATGAGCCCATGTGGCATCTACTCGAGTAGATGCCACATGGGCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_019886.2-219s1c1
Sequence:CCGGCGCTGCTGTTGGTGCTGTACACTCGAGTGTACAGCACCAACAGCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294187    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-469s21c1
Sequence:CCGGTCGCGAGAAGCAGCACATCTACTCGAGTAGATGTGCTGCTTCTCGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 2 Clone ID:NM_019886.2-520s21c1
Sequence:CCGGCTTCCTGGGCGAACTCTTTAACTCGAGTTAAAGAGTTCGCCCAGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294185    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019886.2-2095s21c1
Sequence:CCGGTAATAGGTCTGGGCAGTATTGCTCGAGCAATACTGCCCAGACCTATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-970s21c1
Sequence:CCGGTGATCCAGGCCTCAACCTGAACTCGAGTTCAGGTTGAGGCCTGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299851    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-757s21c1
Sequence:CCGGCTGGCGGACTAACAAGGTCATCTCGAGATGACCTTGTTAGTCCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-1378s21c1
Sequence:CCGGCGATGCCTTCGCGCTCAACATCTCGAGATGTTGAGCGCGAAGGCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369853    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019886.2-1871s21c1
Sequence:CCGGACAGTGCAATGTGGATATTTACTCGAGTAAATATCCACATTGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019886.2-1282s21c1
Sequence:CCGGCTACCTGAGGCTGCGCTATGACTCGAGTCATAGCGCAGCCTCAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021715
CHST7 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021715.1-1810s1c1
Sequence:CCGGGCTGAGATGAAGTTTCCAGAACTCGAGTTCTGGAAACTTCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-1341s1c1
Sequence:CCGGCTTGATGCCTTCGCATTCAATCTCGAGATTGAATGCGAAGGCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-613s1c1
Sequence:CCGGGCTCCCTCTTCCGCTGTGATTCTCGAGAATCACAGCGGAAGAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-945s1c1
Sequence:CCGGCTCAACCTAAAGGTGGTGCAACTCGAGTTGCACCACCTTTAGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-1143s1c1
Sequence:CCGGCCACGCGCTGATTTCTTCTTACTCGAGTAAGAAGAAATCAGCGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-870s21c1
Sequence:CCGGTACCCGGTGGTGGTCATCAAACTCGAGTTTGATGACCACCACCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-935s21c1
Sequence:CCGGTGACCCAGGCCTCAACCTAAACTCGAGTTTAGGTTGAGGCCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021715.1-1810s21c1
Sequence:CCGGGCTGAGATGAAGTTTCCAGAACTCGAGTTCTGGAAACTTCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-1342s21c1
Sequence:CCGGTTGATGCCTTCGCATTCAATACTCGAGTATTGAATGCGAAGGCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-613s21c1
Sequence:CCGGGCTCCCTCTTCCGCTGTGATTCTCGAGAATCACAGCGGAAGAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-802s21c1
Sequence:CCGGAGGACAAAGCCTGCGAAAGTACTCGAGTACTTTCGCAGGCTTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021715
CHST7 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021715.1-1810s1c1
Sequence:CCGGGCTGAGATGAAGTTTCCAGAACTCGAGTTCTGGAAACTTCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-1341s1c1
Sequence:CCGGCTTGATGCCTTCGCATTCAATCTCGAGATTGAATGCGAAGGCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-613s1c1
Sequence:CCGGGCTCCCTCTTCCGCTGTGATTCTCGAGAATCACAGCGGAAGAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-945s1c1
Sequence:CCGGCTCAACCTAAAGGTGGTGCAACTCGAGTTGCACCACCTTTAGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-1143s1c1
Sequence:CCGGCCACGCGCTGATTTCTTCTTACTCGAGTAAGAAGAAATCAGCGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-870s21c1
Sequence:CCGGTACCCGGTGGTGGTCATCAAACTCGAGTTTGATGACCACCACCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-935s21c1
Sequence:CCGGTGACCCAGGCCTCAACCTAAACTCGAGTTTAGGTTGAGGCCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021715.1-1810s21c1
Sequence:CCGGGCTGAGATGAAGTTTCCAGAACTCGAGTTCTGGAAACTTCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-1342s21c1
Sequence:CCGGTTGATGCCTTCGCATTCAATACTCGAGTATTGAATGCGAAGGCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-613s21c1
Sequence:CCGGGCTCCCTCTTCCGCTGTGATTCTCGAGAATCACAGCGGAAGAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-802s21c1
Sequence:CCGGAGGACAAAGCCTGCGAAAGTACTCGAGTACTTTCGCAGGCTTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021715
CHST7 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103360    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021715.1-1810s1c1
Sequence:CCGGGCTGAGATGAAGTTTCCAGAACTCGAGTTCTGGAAACTTCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-1341s1c1
Sequence:CCGGCTTGATGCCTTCGCATTCAATCTCGAGATTGAATGCGAAGGCATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-613s1c1
Sequence:CCGGGCTCCCTCTTCCGCTGTGATTCTCGAGAATCACAGCGGAAGAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-945s1c1
Sequence:CCGGCTCAACCTAAAGGTGGTGCAACTCGAGTTGCACCACCTTTAGGTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021715.1-1143s1c1
Sequence:CCGGCCACGCGCTGATTTCTTCTTACTCGAGTAAGAAGAAATCAGCGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374879    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-870s21c1
Sequence:CCGGTACCCGGTGGTGGTCATCAAACTCGAGTTTGATGACCACCACCGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348490    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-935s21c1
Sequence:CCGGTGACCCAGGCCTCAACCTAAACTCGAGTTTAGGTTGAGGCCTGGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021715.1-1810s21c1
Sequence:CCGGGCTGAGATGAAGTTTCCAGAACTCGAGTTCTGGAAACTTCATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348413    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-1342s21c1
Sequence:CCGGTTGATGCCTTCGCATTCAATACTCGAGTATTGAATGCGAAGGCATCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-613s21c1
Sequence:CCGGGCTCCCTCTTCCGCTGTGATTCTCGAGAATCACAGCGGAAGAGGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021715.1-802s21c1
Sequence:CCGGAGGACAAAGCCTGCGAAAGTACTCGAGTACTTTCGCAGGCTTTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks