EMAIL THIS PAGE TO A FRIEND

CHST8

carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8

68 Gene Product Result for
Synonyms: GALNAC4ST1 GalNAc4ST
UniProtKB ID: Q9H2A9, Q9H3N2
Gene ID:
Human(64377) Summary: The protein encoded by this gene belongs to the sulfotransferase 2 family. It is predominantly expressed in the pituitary gland, and is localized to the golgi membrane. This protein catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. It is responsible for sulfation of GalNAc on luteinizing hormone (LH), which is required for production of the sex hormones. Mice lacking this enzyme, exhibit increased levels of circulating LH, and precocious sexual maturation of both male and female mice. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(68947) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Rat(308511) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Zebrafish(796549) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
chicken(769263) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
dog(484596) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
cow(100271926) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Horse(100050006) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
domestic cat(101090569) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
naked mole-rat(101724961) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
domestic guinea pig(100721873) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
sheep(101118812) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Domestic Rabbit(100355847) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022467 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127895 Rosetta Predictions human pricing
NM_001127896 Rosetta Predictions human pricing
NM_022467 Rosetta Predictions human pricing
NM_001107504 Rosetta Predictions rat pricing
NM_175140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330434 predicted 632
2 SASI_Hs02_00330435 predicted 1724
3 SASI_Hs02_00330436 predicted 727
4 SASI_Hs02_00330437 predicted 518
5 SASI_Hs02_00330438 predicted 1744
6 SASI_Hs02_00330439 predicted 1342
7 SASI_Hs02_00330440 predicted 1234
8 SASI_Hs02_00330441 predicted 1548
9 SASI_Hs02_00330442 predicted 1755
10 SASI_Hs02_00330443 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330444 predicted 541
2 SASI_Hs02_00330445 predicted 1637
3 SASI_Hs02_00330446 predicted 638
4 SASI_Hs02_00330447 predicted 430
5 SASI_Hs02_00330448 predicted 1652
6 SASI_Hs02_00330449 predicted 1256
7 SASI_Hs02_00330450 predicted 1152
8 SASI_Hs02_00330451 predicted 1462
9 SASI_Hs02_00330452 predicted 1670
10 SASI_Hs02_00330453 predicted 1153
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205451 predicted 887
2 SASI_Hs01_00205452 predicted 1984
3 SASI_Hs01_00205453 predicted 972
4 SASI_Hs01_00205455 predicted 776
5 SASI_Hs01_00205456 predicted 1997
6 SASI_Hs02_00355740 predicted 1597
7 SASI_Hs01_00205457 predicted 1491
8 SASI_Hs01_00205458 predicted 1803
9 SASI_Hs01_00205459 predicted 2007
10 SASI_Hs01_00205460 predicted 1495
11 SASI_Hs01_00205454 predicted 1972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229475 predicted 1443
2 SASI_Rn02_00229476 predicted 1226
3 SASI_Rn02_00229477 predicted 532
4 SASI_Rn02_00229478 predicted 1585
5 SASI_Rn02_00229479 predicted 1810
6 SASI_Rn02_00229480 predicted 1218
7 SASI_Rn02_00229481 predicted 1531
8 SASI_Rn02_00229482 predicted 1156
9 SASI_Rn02_00229483 predicted 1709
10 SASI_Rn02_00229484 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00105505 predicted 537
2 SASI_Mm01_00105506 predicted 1453
3 SASI_Mm01_00105507 predicted 1833
4 SASI_Mm01_00105508 predicted 1591
5 SASI_Mm02_00345775 predicted 1605
6 SASI_Mm01_00105509 predicted 1085
7 SASI_Mm01_00105511 predicted 1616
8 SASI_Mm01_00105512 predicted 1835
9 SASI_Mm01_00105513 predicted 581
10 SASI_Mm01_00105514 predicted 1077
11 SASI_Mm01_00105510 predicted 1497
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022467
CHST8 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-1991s21c1
Sequence:CCGGCCTGATGTTCAACTATTCCAACTCGAGTTGGAATAGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-884s21c1
Sequence:CCGGGCCAGGAATAAAGTTCAACATCTCGAGATGTTGAACTTTATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-1424s21c1
Sequence:CCGGCCAGCACAACACCGTCCACTACTCGAGTAGTGGACGGTGTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-1970s21c1
Sequence:CCGGCGACTTCTACTACATGGATTACTCGAGTAATCCATGTAGTAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1970s1c1
Sequence:CCGGCGACTTCTACTACATGGATTACTCGAGTAATCCATGTAGTAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-884s1c1
Sequence:CCGGGCCAGGAATAAAGTTCAACATCTCGAGATGTTGAACTTTATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1778s1c1
Sequence:CCGGCGACTACGATTTCGTAGGCAACTCGAGTTGCCTACGAAATCGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1991s1c1
Sequence:CCGGCCTGATGTTCAACTATTCCAACTCGAGTTGGAATAGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1424s1c1
Sequence:CCGGCCAGCACAACACCGTCCACTACTCGAGTAGTGGACGGTGTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022467
CHST8 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-1991s21c1
Sequence:CCGGCCTGATGTTCAACTATTCCAACTCGAGTTGGAATAGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-884s21c1
Sequence:CCGGGCCAGGAATAAAGTTCAACATCTCGAGATGTTGAACTTTATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-1424s21c1
Sequence:CCGGCCAGCACAACACCGTCCACTACTCGAGTAGTGGACGGTGTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-1970s21c1
Sequence:CCGGCGACTTCTACTACATGGATTACTCGAGTAATCCATGTAGTAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1970s1c1
Sequence:CCGGCGACTTCTACTACATGGATTACTCGAGTAATCCATGTAGTAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-884s1c1
Sequence:CCGGGCCAGGAATAAAGTTCAACATCTCGAGATGTTGAACTTTATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1778s1c1
Sequence:CCGGCGACTACGATTTCGTAGGCAACTCGAGTTGCCTACGAAATCGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1991s1c1
Sequence:CCGGCCTGATGTTCAACTATTCCAACTCGAGTTGGAATAGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1424s1c1
Sequence:CCGGCCAGCACAACACCGTCCACTACTCGAGTAGTGGACGGTGTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022467
CHST8 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307655    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-1991s21c1
Sequence:CCGGCCTGATGTTCAACTATTCCAACTCGAGTTGGAATAGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291244    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-884s21c1
Sequence:CCGGGCCAGGAATAAAGTTCAACATCTCGAGATGTTGAACTTTATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-1424s21c1
Sequence:CCGGCCAGCACAACACCGTCCACTACTCGAGTAGTGGACGGTGTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022467.3-1970s21c1
Sequence:CCGGCGACTTCTACTACATGGATTACTCGAGTAATCCATGTAGTAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1970s1c1
Sequence:CCGGCGACTTCTACTACATGGATTACTCGAGTAATCCATGTAGTAGAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-884s1c1
Sequence:CCGGGCCAGGAATAAAGTTCAACATCTCGAGATGTTGAACTTTATTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1778s1c1
Sequence:CCGGCGACTACGATTTCGTAGGCAACTCGAGTTGCCTACGAAATCGTAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1991s1c1
Sequence:CCGGCCTGATGTTCAACTATTCCAACTCGAGTTGGAATAGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022467.3-1424s1c1
Sequence:CCGGCCAGCACAACACCGTCCACTACTCGAGTAGTGGACGGTGTTGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175140
CHST8 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175140.3-1874s1c1
Sequence:CCGGCGACTCGGATGGATGCTTTAACTCGAGTTAAAGCATCCATCCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-1629s1c1
Sequence:CCGGCCTGATGTTCAACTACTCCAACTCGAGTTGGAGTAGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-1134s1c1
Sequence:CCGGCCGCCTCAGTACCTACACCAACTCGAGTTGGTGTAGGTACTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-534s1c1
Sequence:CCGGCCAGCAAGTTCCAGGTATAAACTCGAGTTTATACCTGGAACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-1137s1c1
Sequence:CCGGCCTCAGTACCTACACCAAGATCTCGAGATCTTGGTGTAGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175140
CHST8 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175140.3-1874s1c1
Sequence:CCGGCGACTCGGATGGATGCTTTAACTCGAGTTAAAGCATCCATCCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-1629s1c1
Sequence:CCGGCCTGATGTTCAACTACTCCAACTCGAGTTGGAGTAGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-1134s1c1
Sequence:CCGGCCGCCTCAGTACCTACACCAACTCGAGTTGGTGTAGGTACTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-534s1c1
Sequence:CCGGCCAGCAAGTTCCAGGTATAAACTCGAGTTTATACCTGGAACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-1137s1c1
Sequence:CCGGCCTCAGTACCTACACCAAGATCTCGAGATCTTGGTGTAGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175140
CHST8 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103120    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175140.3-1874s1c1
Sequence:CCGGCGACTCGGATGGATGCTTTAACTCGAGTTAAAGCATCCATCCGAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-1629s1c1
Sequence:CCGGCCTGATGTTCAACTACTCCAACTCGAGTTGGAGTAGTTGAACATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-1134s1c1
Sequence:CCGGCCGCCTCAGTACCTACACCAACTCGAGTTGGTGTAGGTACTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-534s1c1
Sequence:CCGGCCAGCAAGTTCCAGGTATAAACTCGAGTTTATACCTGGAACTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175140.3-1137s1c1
Sequence:CCGGCCTCAGTACCTACACCAAGATCTCGAGATCTTGGTGTAGGTACTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks