EMAIL THIS PAGE TO A FRIEND

CHST9

carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9

113 Gene Product Result for
Synonyms: GALNAC4ST-2
UniProtKB ID: Q7L1S5, Q6UX69, Q9BXH3, Q9BXH4, Q9BZW9
Gene ID:
Human(83539) Summary: The protein encoded by this gene belongs to the sulfotransferase 2 family. It is localized to the golgi membrane, and catalyzes the transfer of sulfate to position 4 of non-reducing N-acetylgalactosamine (GalNAc) residues in both N-glycans and O-glycans. Sulfate groups on carbohydrates confer highly specific functions to glycoproteins, glycolipids, and proteoglycans, and are critical for cell-cell interaction, signal transduction, and embryonic development. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Aug 2011]
Mouse(71367) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Rat(291770) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
sheep(101116693) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Domestic Rabbit(100341864) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
domestic guinea pig(100716561) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
naked mole-rat(101701023) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
chicken(421089) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
dog(100688744) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
domestic cat(101081259) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
cow(525909) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Horse(100051969) carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031422 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031422 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031422 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_199055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_199055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_199055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU019211 MISSION® esiRNA esiRNA targeting human CHST9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031422 Rosetta Predictions human pricing
XM_001073363 Rosetta Predictions rat pricing
XM_226142 Rosetta Predictions rat pricing
NM_199055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031422 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165776 predicted 1035
2 SASI_Hs01_00165777 predicted 912
3 SASI_Hs01_00165778 predicted 582
4 SASI_Hs01_00165779 predicted 1683
5 SASI_Hs01_00165780 predicted 1040
6 SASI_Hs02_00358810 predicted 1217
7 SASI_Hs01_00165781 predicted 1071
8 SASI_Hs01_00165783 predicted 1623
9 SASI_Hs01_00165784 predicted 1455
10 SASI_Hs01_00165785 predicted 1419
11 SASI_Hs01_00165782 predicted 1413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342535 predicted 352
2 SASI_Rn02_00342536 predicted 507
3 SASI_Rn02_00342537 predicted 1334
4 SASI_Rn02_00342538 predicted 1093
5 SASI_Rn02_00342539 predicted 637
6 SASI_Rn02_00342540 predicted 226
7 SASI_Rn02_00342541 predicted 1325
8 SASI_Rn02_00342542 predicted 933
9 SASI_Rn02_00342543 predicted 753
10 SASI_Rn02_00342544 predicted 1113
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_226142 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383370 predicted 1380
2 SASI_Rn02_00383371 predicted 1425
3 SASI_Rn02_00383372 predicted 1335
4 SASI_Rn02_00383373 predicted 1094
5 SASI_Rn02_00383374 predicted 1323
6 SASI_Rn02_00383375 predicted 1536
7 SASI_Rn02_00383376 predicted 1463
8 SASI_Rn02_00383377 predicted 1110
9 SASI_Rn02_00383378 predicted 1054
10 SASI_Rn02_00383379 predicted 1309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129347 predicted 455
2 SASI_Mm01_00129348 predicted 734
3 SASI_Mm01_00129349 predicted 751
4 SASI_Mm01_00129350 predicted 632
5 SASI_Mm01_00129351 predicted 501
6 SASI_Mm01_00129352 predicted 753
7 SASI_Mm01_00129353 predicted 851
8 SASI_Mm01_00129355 predicted 677
9 SASI_Mm01_00129356 predicted 669
10 SASI_Mm02_00351332 predicted 768
11 SASI_Mm01_00129354 predicted 985
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031422
CHST9 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-697s1c1
Sequence:CCGGCCCAAGAGAAACGAAGGTCTTCTCGAGAAGACCTTCGTTTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-1126s1c1
Sequence:CCGGCCTGTGAAGAAGCATTAATTACTCGAGTAATTAATGCTTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-248s1c1
Sequence:CCGGGCTACTCCTCTTCATGTATTTCTCGAGAAATACATGAAGAGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-787s1c1
Sequence:CCGGCCAGAATCTATGTAGAAGATACTCGAGTATCTTCTACATAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-980s1c1
Sequence:CCGGCCGCTTAAATACTTACACCAACTCGAGTTGGTGTAAGTATTTAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031422.4-1057s21c1
Sequence:CCGGGCTAGATAGCTTTGACCTAAACTCGAGTTTAGGTCAAAGCTATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031422.4-1196s21c1
Sequence:CCGGGTATTCGGAAAGGCAATTATCCTCGAGGATAATTGCCTTTCCGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031422
CHST9 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-697s1c1
Sequence:CCGGCCCAAGAGAAACGAAGGTCTTCTCGAGAAGACCTTCGTTTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-1126s1c1
Sequence:CCGGCCTGTGAAGAAGCATTAATTACTCGAGTAATTAATGCTTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-248s1c1
Sequence:CCGGGCTACTCCTCTTCATGTATTTCTCGAGAAATACATGAAGAGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-787s1c1
Sequence:CCGGCCAGAATCTATGTAGAAGATACTCGAGTATCTTCTACATAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-980s1c1
Sequence:CCGGCCGCTTAAATACTTACACCAACTCGAGTTGGTGTAAGTATTTAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031422.4-1057s21c1
Sequence:CCGGGCTAGATAGCTTTGACCTAAACTCGAGTTTAGGTCAAAGCTATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031422.4-1196s21c1
Sequence:CCGGGTATTCGGAAAGGCAATTATCCTCGAGGATAATTGCCTTTCCGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031422
CHST9 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035154    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-697s1c1
Sequence:CCGGCCCAAGAGAAACGAAGGTCTTCTCGAGAAGACCTTCGTTTCTCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-1126s1c1
Sequence:CCGGCCTGTGAAGAAGCATTAATTACTCGAGTAATTAATGCTTCTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-248s1c1
Sequence:CCGGGCTACTCCTCTTCATGTATTTCTCGAGAAATACATGAAGAGGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-787s1c1
Sequence:CCGGCCAGAATCTATGTAGAAGATACTCGAGTATCTTCTACATAGATTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031422.1-980s1c1
Sequence:CCGGCCGCTTAAATACTTACACCAACTCGAGTTGGTGTAAGTATTTAAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031422.4-1057s21c1
Sequence:CCGGGCTAGATAGCTTTGACCTAAACTCGAGTTTAGGTCAAAGCTATCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031422.4-1196s21c1
Sequence:CCGGGTATTCGGAAAGGCAATTATCCTCGAGGATAATTGCCTTTCCGAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_199055
CHST9 MISSION shRNA Bacterial Glycerol Stock
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-506s1c1
Sequence:CCGGGCAAGAAATATGGTAGAGTAACTCGAGTTACTCTACCATATTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-1207s1c1
Sequence:CCGGGCCGAAAGACAGCTCATCTATCTCGAGATAGATGAGCTGTCTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-973s1c1
Sequence:CCGGCGTCCAGTAGGAATGGATATTCTCGAGAATATCCATTCCTACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-505s1c1
Sequence:CCGGTGCAAGAAATATGGTAGAGTACTCGAGTACTCTACCATATTTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-753s1c1
Sequence:CCGGGCGTTTGAATACATATACCAACTCGAGTTGGTATATGTATTCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_199055
CHST9 MISSION shRNA shRNA Plasmid DNA
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-506s1c1
Sequence:CCGGGCAAGAAATATGGTAGAGTAACTCGAGTTACTCTACCATATTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-1207s1c1
Sequence:CCGGGCCGAAAGACAGCTCATCTATCTCGAGATAGATGAGCTGTCTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-973s1c1
Sequence:CCGGCGTCCAGTAGGAATGGATATTCTCGAGAATATCCATTCCTACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-505s1c1
Sequence:CCGGTGCAAGAAATATGGTAGAGTACTCGAGTACTCTACCATATTTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-753s1c1
Sequence:CCGGGCGTTTGAATACATATACCAACTCGAGTTGGTATATGTATTCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_199055
CHST9 MISSION shRNA Lentiviral Transduction Particles
carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-506s1c1
Sequence:CCGGGCAAGAAATATGGTAGAGTAACTCGAGTTACTCTACCATATTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-1207s1c1
Sequence:CCGGGCCGAAAGACAGCTCATCTATCTCGAGATAGATGAGCTGTCTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-973s1c1
Sequence:CCGGCGTCCAGTAGGAATGGATATTCTCGAGAATATCCATTCCTACTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-505s1c1
Sequence:CCGGTGCAAGAAATATGGTAGAGTACTCGAGTACTCTACCATATTTCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_199055.1-753s1c1
Sequence:CCGGGCGTTTGAATACATATACCAACTCGAGTTGGTATATGTATTCAAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks