EMAIL THIS PAGE TO A FRIEND

CHSY1

chondroitin sulfate synthase 1

139 Gene Product Result for
Synonyms: CHSY CSS1 ChSy-1 TPBS
UniProtKB ID: Q86X52, Q6UX38, Q7LFU5, Q9Y2J5
Gene ID:
Human(22856) Summary: This gene encodes a member of the chondroitin N-acetylgalactosaminyltransferase family. These enzymes possess dual glucuronyltransferase and galactosaminyltransferase activity and play critical roles in the biosynthesis of chondroitin sulfate, a glycosaminoglycan involved in many biological processes including cell proliferation and morphogenesis. Decreased expression of this gene may play a role in colorectal cancer, and mutations in this gene are a cause of temtamy preaxial brachydactyly syndrome. [provided by RefSeq, Dec 2011]
Mouse(269941) chondroitin sulfate synthase 1
Rat(292999) chondroitin sulfate synthase 1
Zebrafish(324407) chondroitin sulfate synthase 1
dog(488704) chondroitin sulfate synthase 1
cow(281690) chondroitin sulfate synthase 1
Horse(100057477) chondroitin sulfate synthase 1
domestic cat(101083179) chondroitin sulfate synthase 1
chicken(415521) chondroitin sulfate synthase 1
naked mole-rat(101700301) chondroitin sulfate synthase 1
domestic guinea pig(100716479) chondroitin sulfate synthase 1
sheep(101109305) chondroitin sulfate synthase 1
Domestic Rabbit(100347427) chondroitin sulfate synthase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014918 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014918 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014918 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081163 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081163 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081163 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014918 Rosetta Predictions human pricing
NM_001106268 Rosetta Predictions rat pricing
NM_001081163 Rosetta Predictions mouse pricing
XM_194358 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014918 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215097 predicted 1885
2 SASI_Hs01_00215098 predicted 984
3 SASI_Hs01_00215099 predicted 2414
4 SASI_Hs02_00346565 predicted 1493
5 SASI_Hs01_00215100 predicted 1426
6 SASI_Hs01_00215101 predicted 2114
7 SASI_Hs01_00215102 predicted 2079
8 SASI_Hs01_00215103 predicted 2213
9 SASI_Hs01_00215105 predicted 2091
10 SASI_Hs01_00215106 predicted 2136
11 SASI_Hs01_00215104 predicted 2673
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106268 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217298 predicted 605
2 SASI_Rn02_00217299 predicted 491
3 SASI_Rn02_00217300 predicted 417
4 SASI_Rn02_00217301 predicted 657
5 SASI_Rn02_00217302 predicted 1012
6 SASI_Rn02_00217303 predicted 1745
7 SASI_Rn02_00217304 predicted 2062
8 SASI_Rn02_00217305 predicted 694
9 SASI_Rn02_00217306 predicted 322
10 SASI_Rn02_00217307 predicted 1497
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081163 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295801 predicted 2450
2 SASI_Mm02_00295802 predicted 2381
3 SASI_Mm02_00295803 predicted 2292
4 SASI_Mm02_00295804 predicted 825
5 SASI_Mm02_00295805 predicted 2256
6 SASI_Mm02_00295806 predicted 2147
7 SASI_Mm02_00295807 predicted 1063
8 SASI_Mm02_00295808 predicted 659
9 SASI_Mm02_00295809 predicted 1873
10 SASI_Mm02_00295810 predicted 1093
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194358 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00224881 predicted 2464
2 SASI_Mm01_00224882 predicted 2378
3 SASI_Mm01_00224883 predicted 2290
4 SASI_Mm01_00224884 predicted 830
5 SASI_Mm01_00224885 predicted 2262
6 SASI_Mm01_00224886 predicted 2152
7 SASI_Mm01_00224887 predicted 1068
8 SASI_Mm01_00224888 predicted 1871
9 SASI_Mm01_00224889 predicted 1101
10 SASI_Mm01_00224890 predicted 1243
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014918
VALIDATED
CHSY1 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate synthase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014918.4-2234s21c1
Sequence:CCGGGATGAGAGATTACCGCATTAACTCGAGTTAATGCGGTAATCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014918.4-1429s21c1
Sequence:CCGGACATGCTGAGCCGCAAGATATCTCGAGATATCTTGCGGCTCAGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014918.4-2964s21c1
Sequence:CCGGGTCCGTATACAAGGATATATTCTCGAGAATATATCCTTGTATACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014918.4-2399s21c1
Sequence:CCGGTCAGCGATGTCGAGCAAATACCTCGAGGTATTTGCTCGACATCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014918.3-2382s1c1
Sequence:CCGGCCTCGTGTTTACTACAGAATTCTCGAGAATTCTGTAGTAAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014918.3-1964s1c1
Sequence:CCGGCCAAGAGAATCAATCAGGAATCTCGAGATTCCTGATTGATTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014918.3-1180s1c1
Sequence:CCGGCGGAGAATGGTGCCGCACATTCTCGAGAATGTGCGGCACCATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014918.3-2339s1c1
Sequence:CCGGCCCAGTTTAACAATGAATCTTCTCGAGAAGATTCATTGTTAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014918.3-1701s1c1
Sequence:CCGGCGACATTGTCATGCAGGTCATCTCGAGATGACCTGCATGACAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014918
VALIDATED
CHSY1 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate synthase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014918.4-2234s21c1
Sequence:CCGGGATGAGAGATTACCGCATTAACTCGAGTTAATGCGGTAATCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014918.4-1429s21c1
Sequence:CCGGACATGCTGAGCCGCAAGATATCTCGAGATATCTTGCGGCTCAGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014918.4-2964s21c1
Sequence:CCGGGTCCGTATACAAGGATATATTCTCGAGAATATATCCTTGTATACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014918.4-2399s21c1
Sequence:CCGGTCAGCGATGTCGAGCAAATACCTCGAGGTATTTGCTCGACATCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014918.3-2382s1c1
Sequence:CCGGCCTCGTGTTTACTACAGAATTCTCGAGAATTCTGTAGTAAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014918.3-1964s1c1
Sequence:CCGGCCAAGAGAATCAATCAGGAATCTCGAGATTCCTGATTGATTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014918.3-1180s1c1
Sequence:CCGGCGGAGAATGGTGCCGCACATTCTCGAGAATGTGCGGCACCATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014918.3-2339s1c1
Sequence:CCGGCCCAGTTTAACAATGAATCTTCTCGAGAAGATTCATTGTTAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014918.3-1701s1c1
Sequence:CCGGCGACATTGTCATGCAGGTCATCTCGAGATGACCTGCATGACAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014918
VALIDATED
CHSY1 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate synthase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014918.4-2234s21c1
Sequence:CCGGGATGAGAGATTACCGCATTAACTCGAGTTAATGCGGTAATCTCTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014918.4-1429s21c1
Sequence:CCGGACATGCTGAGCCGCAAGATATCTCGAGATATCTTGCGGCTCAGCATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425320    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014918.4-2964s21c1
Sequence:CCGGGTCCGTATACAAGGATATATTCTCGAGAATATATCCTTGTATACGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014918.4-2399s21c1
Sequence:CCGGTCAGCGATGTCGAGCAAATACCTCGAGGTATTTGCTCGACATCGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014918.3-2382s1c1
Sequence:CCGGCCTCGTGTTTACTACAGAATTCTCGAGAATTCTGTAGTAAACACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014918.3-1964s1c1
Sequence:CCGGCCAAGAGAATCAATCAGGAATCTCGAGATTCCTGATTGATTCTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014918.3-1180s1c1
Sequence:CCGGCGGAGAATGGTGCCGCACATTCTCGAGAATGTGCGGCACCATTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014918.3-2339s1c1
Sequence:CCGGCCCAGTTTAACAATGAATCTTCTCGAGAAGATTCATTGTTAAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_014918.3-1701s1c1
Sequence:CCGGCGACATTGTCATGCAGGTCATCTCGAGATGACCTGCATGACAATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081163
VALIDATED
CHSY1 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate synthase 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000252619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-1110s21c1
Sequence:CCGGTGGCAAGTGTCTCCGGGAAATCTCGAGATTTCCCGGAGACACTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-3588s21c1
Sequence:CCGGGTGTAATGAGTGCGAGCTAAACTCGAGTTTAGCTCGCACTCATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-2636s21c1
Sequence:CCGGCTGTCGTCTGTGACCCTAATCCTCGAGGATTAGGGTCACAGACGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-1241s21c1
Sequence:CCGGAGAACAAGAAAGGGTACATTACTCGAGTAATGTACCCTTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081163
VALIDATED
CHSY1 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate synthase 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000252619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-1110s21c1
Sequence:CCGGTGGCAAGTGTCTCCGGGAAATCTCGAGATTTCCCGGAGACACTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-3588s21c1
Sequence:CCGGGTGTAATGAGTGCGAGCTAAACTCGAGTTTAGCTCGCACTCATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-2636s21c1
Sequence:CCGGCTGTCGTCTGTGACCCTAATCCTCGAGGATTAGGGTCACAGACGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-1241s21c1
Sequence:CCGGAGAACAAGAAAGGGTACATTACTCGAGTAATGTACCCTTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081163
VALIDATED
CHSY1 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate synthase 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000252619    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-1110s21c1
Sequence:CCGGTGGCAAGTGTCTCCGGGAAATCTCGAGATTTCCCGGAGACACTTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252618    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-3588s21c1
Sequence:CCGGGTGTAATGAGTGCGAGCTAAACTCGAGTTTAGCTCGCACTCATTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-2636s21c1
Sequence:CCGGCTGTCGTCTGTGACCCTAATCCTCGAGGATTAGGGTCACAGACGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081163.1-1241s21c1
Sequence:CCGGAGAACAAGAAAGGGTACATTACTCGAGTAATGTACCCTTTCTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks