EMAIL THIS PAGE TO A FRIEND

CHSY3

chondroitin sulfate synthase 3

82 Gene Product Result for
Synonyms: CHSY2 CSS3
UniProtKB ID: Q70JA7, B2RP97, Q76L22, Q86Y52
Gene ID:
Human(337876) Summary: CSS3 is a glycosyltransferase that has both glucuronyltransferase and N-acetylgalactosaminyltransferase activities (Yada et al., 2003 [PubMed 12907687]
Mouse(78923) chondroitin sulfate synthase 3
Rat(291577) chondroitin sulfate synthase 3
sheep(101104485) chondroitin sulfate synthase 3
domestic guinea pig(100713222) chondroitin sulfate synthase 3
naked mole-rat(101701741) chondroitin sulfate synthase 3
Zebrafish(368477) chondroitin sulfate synthase 3
cow(528149) chondroitin sulfate synthase 3
Horse(100072984) chondroitin sulfate synthase 3
domestic cat(101092580) chondroitin sulfate synthase 3
dog(481492) chondroitin sulfate synthase 3
chicken(415598) chondroitin sulfate synthase 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175856 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175856 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175856 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001081328 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081328 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081328 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175856 Rosetta Predictions human pricing
XM_001060886 Rosetta Predictions rat pricing
XM_225912 Rosetta Predictions rat pricing
NM_001081328 Rosetta Predictions mouse pricing
XM_894542 Rosetta Predictions mouse pricing
XM_901640 Rosetta Predictions mouse pricing
XM_901645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175856 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211698 predicted 2322
2 SASI_Hs01_00211699 predicted 1674
3 SASI_Hs01_00211700 predicted 938
4 SASI_Hs01_00211701 predicted 1684
5 SASI_Hs01_00211702 predicted 1737
6 SASI_Hs01_00211703 predicted 1158
7 SASI_Hs01_00211704 predicted 1899
8 SASI_Hs01_00211705 predicted 790
9 SASI_Hs02_00369129 predicted 971
10 SASI_Hs01_00211707 predicted 1088
11 SASI_Hs01_00211706 predicted 1752
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298055 predicted 855
2 SASI_Rn02_00298056 predicted 1275
3 SASI_Rn02_00298057 predicted 2120
4 SASI_Rn02_00298058 predicted 2628
5 SASI_Rn02_00298059 predicted 2680
6 SASI_Rn02_00298060 predicted 2753
7 SASI_Rn02_00298061 predicted 2541
8 SASI_Rn02_00298062 predicted 1346
9 SASI_Rn02_00298063 predicted 1118
10 SASI_Rn02_00298064 predicted 1887
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00383230 predicted 1873
2 SASI_Rn02_00383231 predicted 852
3 SASI_Rn02_00383232 predicted 1669
4 SASI_Rn02_00383233 predicted 1275
5 SASI_Rn02_00383234 predicted 2123
6 SASI_Rn02_00383235 predicted 1125
7 SASI_Rn02_00383236 predicted 1345
8 SASI_Rn02_00383237 predicted 1882
9 SASI_Rn02_00383238 predicted 2031
10 SASI_Rn02_00383239 predicted 2067
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081328 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00297341 predicted 2122
2 SASI_Mm02_00297342 predicted 854
3 SASI_Mm02_00297343 predicted 2125
4 SASI_Mm02_00297344 predicted 2678
5 SASI_Mm02_00297345 predicted 1274
6 SASI_Mm02_00297346 predicted 2175
7 SASI_Mm02_00297347 predicted 1877
8 SASI_Mm02_00297348 predicted 1893
9 SASI_Mm02_00297349 predicted 2542
10 SASI_Mm02_00297350 predicted 1123
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_894542 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219235 predicted 2122
2 SASI_Mm01_00219236 predicted 866
3 SASI_Mm01_00219237 predicted 2124
4 SASI_Mm01_00219238 predicted 2687
5 SASI_Mm01_00219239 predicted 1283
6 SASI_Mm01_00219240 predicted 2177
7 SASI_Mm01_00219241 predicted 1893
8 SASI_Mm01_00219242 predicted 2551
9 SASI_Mm01_00219243 predicted 1135
10 SASI_Mm01_00219244 predicted 2354
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226775 predicted 1530
2 SASI_Mm01_00226776 predicted 861
3 SASI_Mm01_00226777 predicted 1519
4 SASI_Mm01_00226778 predicted 1201
5 SASI_Mm01_00226779 predicted 1285
6 SASI_Mm01_00226780 predicted 1376
7 SASI_Mm01_00226781 predicted 1123
8 SASI_Mm01_00226782 predicted 1496
9 SASI_Mm01_00226783 predicted 1330
10 SASI_Mm01_00226784 predicted 1451
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_901645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00247917 predicted 1346
2 SASI_Mm01_00247918 predicted 1592
3 SASI_Mm01_00247919 predicted 1308
4 SASI_Mm01_00247920 predicted 1440
5 SASI_Mm01_00247921 predicted 1745
6 SASI_Mm01_00247922 predicted 1561
7 SASI_Mm01_00247923 predicted 1389
8 SASI_Mm01_00247924 predicted 1346
9 SASI_Mm01_00247925 predicted 1359
10 SASI_Mm01_00247926 predicted 1086
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175856
VALIDATED
CHSY3 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate synthase 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175856.3-978s1c1
Sequence:CCGGGCCACATATTGGTGAATGCCTCTCGAGAGGCATTCACCAATATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-2523s1c1
Sequence:CCGGCTTGGACCCTAAGCAGTATAACTCGAGTTATACTGCTTAGGGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-1552s1c1
Sequence:CCGGGACTTCAAGGAAATTCAGTATCTCGAGATACTGAATTTCCTTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175856.3-814s1c1
Sequence:CCGGGAAGAGTTTCTTAGATCGCTACTCGAGTAGCGATCTAAGAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-2188s1c1
Sequence:CCGGCGATGTAGAGACAATACAATTCTCGAGAATTGTATTGTCTCTACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-2001s1c1
Sequence:CCGGCAGCAAGCATATTGAGCTGATCTCGAGATCAGCTCAATATGCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175856.3-979s1c1
Sequence:CCGGCCACATATTGGTGAATGCCTTCTCGAGAAGGCATTCACCAATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175856.4-2210s21c1
Sequence:CCGGAGGGACAACAGGTGTACTATCCTCGAGGATAGTACACCTGTTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175856.4-2337s21c1
Sequence:CCGGATATGGCATCACCTGTATTTACTCGAGTAAATACAGGTGATGCCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175856
VALIDATED
CHSY3 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate synthase 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175856.3-978s1c1
Sequence:CCGGGCCACATATTGGTGAATGCCTCTCGAGAGGCATTCACCAATATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-2523s1c1
Sequence:CCGGCTTGGACCCTAAGCAGTATAACTCGAGTTATACTGCTTAGGGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-1552s1c1
Sequence:CCGGGACTTCAAGGAAATTCAGTATCTCGAGATACTGAATTTCCTTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175856.3-814s1c1
Sequence:CCGGGAAGAGTTTCTTAGATCGCTACTCGAGTAGCGATCTAAGAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-2188s1c1
Sequence:CCGGCGATGTAGAGACAATACAATTCTCGAGAATTGTATTGTCTCTACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-2001s1c1
Sequence:CCGGCAGCAAGCATATTGAGCTGATCTCGAGATCAGCTCAATATGCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175856.3-979s1c1
Sequence:CCGGCCACATATTGGTGAATGCCTTCTCGAGAAGGCATTCACCAATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175856.4-2210s21c1
Sequence:CCGGAGGGACAACAGGTGTACTATCCTCGAGGATAGTACACCTGTTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175856.4-2337s21c1
Sequence:CCGGATATGGCATCACCTGTATTTACTCGAGTAAATACAGGTGATGCCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175856
VALIDATED
CHSY3 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate synthase 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163437    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175856.3-978s1c1
Sequence:CCGGGCCACATATTGGTGAATGCCTCTCGAGAGGCATTCACCAATATGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-2523s1c1
Sequence:CCGGCTTGGACCCTAAGCAGTATAACTCGAGTTATACTGCTTAGGGTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-1552s1c1
Sequence:CCGGGACTTCAAGGAAATTCAGTATCTCGAGATACTGAATTTCCTTGAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158945    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175856.3-814s1c1
Sequence:CCGGGAAGAGTTTCTTAGATCGCTACTCGAGTAGCGATCTAAGAAACTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-2188s1c1
Sequence:CCGGCGATGTAGAGACAATACAATTCTCGAGAATTGTATTGTCTCTACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_175856.3-2001s1c1
Sequence:CCGGCAGCAAGCATATTGAGCTGATCTCGAGATCAGCTCAATATGCTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161827    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175856.3-979s1c1
Sequence:CCGGCCACATATTGGTGAATGCCTTCTCGAGAAGGCATTCACCAATATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175856.4-2210s21c1
Sequence:CCGGAGGGACAACAGGTGTACTATCCTCGAGGATAGTACACCTGTTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175856.4-2337s21c1
Sequence:CCGGATATGGCATCACCTGTATTTACTCGAGTAAATACAGGTGATGCCATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178636
CHSY3 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate synthase 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178636.2-3085s1c1
Sequence:CCGGGCCTCCTAAATAATGTAACTTCTCGAGAAGTTACATTATTTAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1057s1c1
Sequence:CCGGGTCCTTCATGATGATCAAGTACTCGAGTACTTGATCATCATGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1176s1c1
Sequence:CCGGCCCACCTCCTAATTCCTTTCTCTCGAGAGAAAGGAATTAGGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1084s1c1
Sequence:CCGGCGACCACTATCTGGACAAGTACTCGAGTACTTGTCCAGATAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1123s1c1
Sequence:CCGGCGACGACGATGTCTACATCAACTCGAGTTGATGTAGACATCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178636
CHSY3 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate synthase 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178636.2-3085s1c1
Sequence:CCGGGCCTCCTAAATAATGTAACTTCTCGAGAAGTTACATTATTTAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1057s1c1
Sequence:CCGGGTCCTTCATGATGATCAAGTACTCGAGTACTTGATCATCATGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1176s1c1
Sequence:CCGGCCCACCTCCTAATTCCTTTCTCTCGAGAGAAAGGAATTAGGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1084s1c1
Sequence:CCGGCGACCACTATCTGGACAAGTACTCGAGTACTTGTCCAGATAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1123s1c1
Sequence:CCGGCGACGACGATGTCTACATCAACTCGAGTTGATGTAGACATCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178636
CHSY3 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate synthase 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094034    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178636.2-3085s1c1
Sequence:CCGGGCCTCCTAAATAATGTAACTTCTCGAGAAGTTACATTATTTAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1057s1c1
Sequence:CCGGGTCCTTCATGATGATCAAGTACTCGAGTACTTGATCATCATGAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1176s1c1
Sequence:CCGGCCCACCTCCTAATTCCTTTCTCTCGAGAGAAAGGAATTAGGAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1084s1c1
Sequence:CCGGCGACCACTATCTGGACAAGTACTCGAGTACTTGTCCAGATAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178636.2-1123s1c1
Sequence:CCGGCGACGACGATGTCTACATCAACTCGAGTTGATGTAGACATCGTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081328
CHSY3 MISSION shRNA Bacterial Glycerol Stock
chondroitin sulfate synthase 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000453007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081328.1-2115s21c1
Sequence:CCGGCACAGTCATTCTCCGTTATATCTCGAGATATAACGGAGAATGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081328.1-2958s21c1
Sequence:CCGGATTTGGGTGTCAGGGATAATCCTCGAGGATTATCCCTGACACCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081328.1-2223s21c1
Sequence:CCGGTCGTTGGAAGGTACGACATTTCTCGAGAAATGTCGTACCTTCCAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081328
CHSY3 MISSION shRNA shRNA Plasmid DNA
chondroitin sulfate synthase 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000453007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081328.1-2115s21c1
Sequence:CCGGCACAGTCATTCTCCGTTATATCTCGAGATATAACGGAGAATGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081328.1-2958s21c1
Sequence:CCGGATTTGGGTGTCAGGGATAATCCTCGAGGATTATCCCTGACACCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081328.1-2223s21c1
Sequence:CCGGTCGTTGGAAGGTACGACATTTCTCGAGAAATGTCGTACCTTCCAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081328
CHSY3 MISSION shRNA Lentiviral Transduction Particles
chondroitin sulfate synthase 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000453007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081328.1-2115s21c1
Sequence:CCGGCACAGTCATTCTCCGTTATATCTCGAGATATAACGGAGAATGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081328.1-2958s21c1
Sequence:CCGGATTTGGGTGTCAGGGATAATCCTCGAGGATTATCCCTGACACCCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081328.1-2223s21c1
Sequence:CCGGTCGTTGGAAGGTACGACATTTCTCGAGAAATGTCGTACCTTCCAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks