EMAIL THIS PAGE TO A FRIEND

CHTF18

CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)

59 Gene Product Result for
Synonyms: C16orf41 C321D2.2 C321D2.3 C321D2.4 CHL12 Ctf18 RUVBL
Gene ID:
Human(63922) Summary: CHTF18, CHTF8 (MIM 613202), and DCC1 (DSCC1; MIM 613203) are components of an alternative replication factor C (RFC) (see MIM 600404) complex that loads PCNA (MIM 176740) onto DNA during S phase of the cell cycle (Merkle et al., 2003 [PubMed 12766176]
Mouse(214901) CTF18, chromosome transmission fidelity factor 18
Rat(287146) CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
Zebrafish(554366) CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
dog(490084) CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
cow(517007) CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
domestic cat(101086774) CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
chicken(416531) CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
naked mole-rat(101709644) CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
domestic guinea pig(100722938) CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
sheep(101105623) CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022092 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022092 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022092 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145409 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145409 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145409 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022092 Rosetta Predictions human pricing
NM_001105773 Rosetta Predictions rat pricing
NM_145409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022092 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148705 predicted 1496
2 SASI_Hs01_00148706 predicted 1344
3 SASI_Hs01_00148707 predicted 2627
4 SASI_Hs01_00148708 predicted 1511
5 SASI_Hs01_00148709 predicted 2061
6 SASI_Hs01_00148710 predicted 2127
7 SASI_Hs01_00148712 predicted 876
8 SASI_Hs01_00148713 predicted 2583
9 SASI_Hs01_00148714 predicted 2400
10 SASI_Hs02_00355477 predicted 466
11 SASI_Hs01_00148711 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105773 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212386 predicted 281
2 SASI_Rn02_00212387 predicted 564
3 SASI_Rn02_00212388 predicted 245
4 SASI_Rn02_00212389 predicted 1799
5 SASI_Rn02_00212390 predicted 1706
6 SASI_Rn02_00212391 predicted 308
7 SASI_Rn02_00212392 predicted 2123
8 SASI_Rn02_00212393 predicted 1704
9 SASI_Rn02_00212394 predicted 1500
10 SASI_Rn02_00212395 predicted 2443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133571 predicted 912
2 SASI_Mm01_00133572 predicted 581
3 SASI_Mm01_00133573 predicted 2582
4 SASI_Mm02_00340742 predicted 1679
5 SASI_Mm01_00133576 predicted 477
6 SASI_Mm01_00133577 predicted 1294
7 SASI_Mm01_00133578 predicted 1499
8 SASI_Mm01_00133579 predicted 1227
9 SASI_Mm01_00133580 predicted 516
10 SASI_Mm02_00340743 predicted 1213
11 SASI_Mm01_00133574 predicted 1499
12 SASI_Mm01_00133575 predicted 2254
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022092
VALIDATED
CHTF18 MISSION shRNA Bacterial Glycerol Stock
CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-2489s21c1
Sequence:CCGGCCGATGGCCAGTACATCTACACTCGAGTGTAGATGTACTGGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-1350s21c1
Sequence:CCGGCAACTGCCTGGTCATCGATGACTCGAGTCATCGATGACCAGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-1504s21c1
Sequence:CCGGCTCCTCATGAGGCCCATTATCCTCGAGGATAATGGGCCTCATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-587s21c1
Sequence:CCGGAGGACTACGTCCACGTGACATCTCGAGATGTCACGTGGACGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_022092.2-2795s21c1
Sequence:CCGGAGCCTGAGAAGGACTTCTTTGCTCGAGCAAAGAAGTCCTTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-2171s21c1
Sequence:CCGGTGGCCTTCCATGTGCTGTTTGCTCGAGCAAACAGCACATGGAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_022092.2-2399s21c1
Sequence:CCGGAGCTGTACAGCACCCGTGAAACTCGAGTTTCACGGGTGCTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_022092.2-945s21c1
Sequence:CCGGGCTCAGTGATGACTTCACCAACTCGAGTTGGTGAAGTCATCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022092.1-1985s1c1
Sequence:CCGGCCAGGGCTTGTTTGACAACTTCTCGAGAAGTTGTCAAACAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022092.1-1478s1c1
Sequence:CCGGGCTCCTCATGAGGCCCATTATCTCGAGATAATGGGCCTCATGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022092.1-186s1c1
Sequence:CCGGCGGACGTTCGAGGAGGCCCTTCTCGAGAAGGGCCTCCTCGAACGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_022092.1-2891s1c1
Sequence:CCGGCGAGGTCTGGTTCCGCTTCAACTCGAGTTGAAGCGGAACCAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_022092.1-920s1c1
Sequence:CCGGGCTCAGTGATGACTTCACCAACTCGAGTTGGTGAAGTCATCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022092
VALIDATED
CHTF18 MISSION shRNA shRNA Plasmid DNA
CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-2489s21c1
Sequence:CCGGCCGATGGCCAGTACATCTACACTCGAGTGTAGATGTACTGGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-1350s21c1
Sequence:CCGGCAACTGCCTGGTCATCGATGACTCGAGTCATCGATGACCAGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-1504s21c1
Sequence:CCGGCTCCTCATGAGGCCCATTATCCTCGAGGATAATGGGCCTCATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-587s21c1
Sequence:CCGGAGGACTACGTCCACGTGACATCTCGAGATGTCACGTGGACGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_022092.2-2795s21c1
Sequence:CCGGAGCCTGAGAAGGACTTCTTTGCTCGAGCAAAGAAGTCCTTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-2171s21c1
Sequence:CCGGTGGCCTTCCATGTGCTGTTTGCTCGAGCAAACAGCACATGGAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_022092.2-2399s21c1
Sequence:CCGGAGCTGTACAGCACCCGTGAAACTCGAGTTTCACGGGTGCTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_022092.2-945s21c1
Sequence:CCGGGCTCAGTGATGACTTCACCAACTCGAGTTGGTGAAGTCATCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022092.1-1985s1c1
Sequence:CCGGCCAGGGCTTGTTTGACAACTTCTCGAGAAGTTGTCAAACAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022092.1-1478s1c1
Sequence:CCGGGCTCCTCATGAGGCCCATTATCTCGAGATAATGGGCCTCATGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022092.1-186s1c1
Sequence:CCGGCGGACGTTCGAGGAGGCCCTTCTCGAGAAGGGCCTCCTCGAACGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_022092.1-2891s1c1
Sequence:CCGGCGAGGTCTGGTTCCGCTTCAACTCGAGTTGAAGCGGAACCAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_022092.1-920s1c1
Sequence:CCGGGCTCAGTGATGACTTCACCAACTCGAGTTGGTGAAGTCATCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022092
VALIDATED
CHTF18 MISSION shRNA Lentiviral Transduction Particles
CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-2489s21c1
Sequence:CCGGCCGATGGCCAGTACATCTACACTCGAGTGTAGATGTACTGGCCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364161    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-1350s21c1
Sequence:CCGGCAACTGCCTGGTCATCGATGACTCGAGTCATCGATGACCAGGCAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-1504s21c1
Sequence:CCGGCTCCTCATGAGGCCCATTATCCTCGAGGATAATGGGCCTCATGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-587s21c1
Sequence:CCGGAGGACTACGTCCACGTGACATCTCGAGATGTCACGTGGACGTAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_022092.2-2795s21c1
Sequence:CCGGAGCCTGAGAAGGACTTCTTTGCTCGAGCAAAGAAGTCCTTCTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303457    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022092.2-2171s21c1
Sequence:CCGGTGGCCTTCCATGTGCTGTTTGCTCGAGCAAACAGCACATGGAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303455    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 2 Clone ID:NM_022092.2-2399s21c1
Sequence:CCGGAGCTGTACAGCACCCGTGAAACTCGAGTTTCACGGGTGCTGTACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_022092.2-945s21c1
Sequence:CCGGGCTCAGTGATGACTTCACCAACTCGAGTTGGTGAAGTCATCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113771    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_022092.1-1985s1c1
Sequence:CCGGCCAGGGCTTGTTTGACAACTTCTCGAGAAGTTGTCAAACAAGCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022092.1-1478s1c1
Sequence:CCGGGCTCCTCATGAGGCCCATTATCTCGAGATAATGGGCCTCATGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022092.1-186s1c1
Sequence:CCGGCGGACGTTCGAGGAGGCCCTTCTCGAGAAGGGCCTCCTCGAACGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_022092.1-2891s1c1
Sequence:CCGGCGAGGTCTGGTTCCGCTTCAACTCGAGTTGAAGCGGAACCAGACCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113772    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_022092.1-920s1c1
Sequence:CCGGGCTCAGTGATGACTTCACCAACTCGAGTTGGTGAAGTCATCACTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145409
VALIDATED
CHTF18 MISSION shRNA Bacterial Glycerol Stock
CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-576s21c3
Sequence:CCGGGCCTCCTATCTTAGAAGATTACTCGAGTAATCTTCTAAGATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-1298s21c1
Sequence:CCGGGCATTGAAGCAGCTACGCAAACTCGAGTTTGCGTAGCTGCTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-1513s21c1
Sequence:CCGGCCTATCATCTGCATCTGCAATCTCGAGATTGCAGATGCAGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-289s21c2
Sequence:CCGGCCAGGAAATGTCAACCGCAATCTCGAGATTGCGGTTGACATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-493s21c1
Sequence:CCGGGCTGGGTATTCAGATGCTAATCTCGAGATTAGCATCTGAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145409.1-1500s1c1
Sequence:CCGGCCTATCATCTGCATCTGCAATCTCGAGATTGCAGATGCAGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145409.1-276s1c1
Sequence:CCGGCCAGGAAATGTCAACCGCAATCTCGAGATTGCGGTTGACATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145409.1-1285s1c1
Sequence:CCGGGCATTGAAGCAGCTACGCAAACTCGAGTTTGCGTAGCTGCTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145409.1-480s1c1
Sequence:CCGGGCTGGGTATTCAGATGCTAATCTCGAGATTAGCATCTGAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145409.1-563s1c1
Sequence:CCGGGCCTCCTATCTTAGAAGATTACTCGAGTAATCTTCTAAGATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145409
VALIDATED
CHTF18 MISSION shRNA shRNA Plasmid DNA
CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-576s21c3
Sequence:CCGGGCCTCCTATCTTAGAAGATTACTCGAGTAATCTTCTAAGATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-1298s21c1
Sequence:CCGGGCATTGAAGCAGCTACGCAAACTCGAGTTTGCGTAGCTGCTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-1513s21c1
Sequence:CCGGCCTATCATCTGCATCTGCAATCTCGAGATTGCAGATGCAGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-289s21c2
Sequence:CCGGCCAGGAAATGTCAACCGCAATCTCGAGATTGCGGTTGACATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-493s21c1
Sequence:CCGGGCTGGGTATTCAGATGCTAATCTCGAGATTAGCATCTGAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145409.1-1500s1c1
Sequence:CCGGCCTATCATCTGCATCTGCAATCTCGAGATTGCAGATGCAGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145409.1-276s1c1
Sequence:CCGGCCAGGAAATGTCAACCGCAATCTCGAGATTGCGGTTGACATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145409.1-1285s1c1
Sequence:CCGGGCATTGAAGCAGCTACGCAAACTCGAGTTTGCGTAGCTGCTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145409.1-480s1c1
Sequence:CCGGGCTGGGTATTCAGATGCTAATCTCGAGATTAGCATCTGAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145409.1-563s1c1
Sequence:CCGGGCCTCCTATCTTAGAAGATTACTCGAGTAATCTTCTAAGATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145409
VALIDATED
CHTF18 MISSION shRNA Lentiviral Transduction Particles
CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-576s21c3
Sequence:CCGGGCCTCCTATCTTAGAAGATTACTCGAGTAATCTTCTAAGATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-1298s21c1
Sequence:CCGGGCATTGAAGCAGCTACGCAAACTCGAGTTTGCGTAGCTGCTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-1513s21c1
Sequence:CCGGCCTATCATCTGCATCTGCAATCTCGAGATTGCAGATGCAGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-289s21c2
Sequence:CCGGCCAGGAAATGTCAACCGCAATCTCGAGATTGCGGTTGACATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145409.2-493s21c1
Sequence:CCGGGCTGGGTATTCAGATGCTAATCTCGAGATTAGCATCTGAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145409.1-1500s1c1
Sequence:CCGGCCTATCATCTGCATCTGCAATCTCGAGATTGCAGATGCAGATGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145409.1-276s1c1
Sequence:CCGGCCAGGAAATGTCAACCGCAATCTCGAGATTGCGGTTGACATTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145409.1-1285s1c1
Sequence:CCGGGCATTGAAGCAGCTACGCAAACTCGAGTTTGCGTAGCTGCTTCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145409.1-480s1c1
Sequence:CCGGGCTGGGTATTCAGATGCTAATCTCGAGATTAGCATCTGAATACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145409.1-563s1c1
Sequence:CCGGGCCTCCTATCTTAGAAGATTACTCGAGTAATCTTCTAAGATAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks