EMAIL THIS PAGE TO A FRIEND

CHTF8

CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)

258 Gene Product Result for
Synonyms: CTF8 DERPC
UniProtKB ID: P0CG13, A8MYX8, Q71E72, Q8NDH8, Q8WV66, Q9NX73
Gene ID:
Human(54921) Summary: This gene encodes a short protein that forms part of the Ctf18 replication factor C (RFC) complex that occurs in both yeast and mammals. The heteroheptameric RFC complex plays a role in sister chromatid cohesion and may load the replication clamp PCNA (proliferating cell nuclear antigen) onto DNA during DNA replication and repair. This gene is ubiquitously expressed and has been shown to have reduced expression in renal and prostate tumors. Alternatively spliced transcript variants have been described. This gene has a pseudogene on chromosome X. [provided by RefSeq, Jan 2010]
Mouse(214987) CTF8, chromosome transmission fidelity factor 8
Rat(364996) CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
sheep(101120008) CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
domestic guinea pig(100725661) CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
naked mole-rat(101718284) CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
Zebrafish(555570) CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
cow(618186) CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
domestic cat(101095869) CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
dog(612884) CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
chicken(769609) CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001002847 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001002847 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001002847 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108511 MISSION® esiRNA esiRNA human AC009027.10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039690 Rosetta Predictions human pricing
NM_001040144 Rosetta Predictions human pricing
NM_001040145 Rosetta Predictions human pricing
NM_001040146 Rosetta Predictions human pricing
NM_001126495 Rosetta Predictions rat pricing
NM_145412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039690 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175844 predicted 716
2 SASI_Hs01_00175846 predicted 411
3 SASI_Hs01_00175847 predicted 953
4 SASI_Hs01_00175848 predicted 212
5 SASI_Hs01_00175849 predicted 175
6 SASI_Hs01_00175850 predicted 295
7 SASI_Hs01_00175851 predicted 789
8 SASI_Hs01_00175852 predicted 406
9 SASI_Hs01_00175853 predicted 229
10 SASI_Hs02_00308638 predicted 375
11 SASI_Hs01_00175845 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040144 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00083077 predicted 664
2 SASI_Hs01_00083079 predicted 353
3 SASI_Hs01_00083080 predicted 891
4 SASI_Hs01_00083081 predicted 157
5 SASI_Hs01_00083082 predicted 232
6 SASI_Hs01_00083083 predicted 728
7 SASI_Hs01_00083084 predicted 344
8 SASI_Hs01_00083085 predicted 171
9 SASI_Hs01_00083086 predicted 317
10 SASI_Hs02_00308854 predicted 145
11 SASI_Hs01_00083078 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040145 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220617 predicted 354
2 SASI_Hs01_00220618 predicted 329
3 SASI_Hs01_00220619 predicted 364
4 SASI_Hs01_00220620 predicted 311
5 SASI_Hs01_00220621 predicted 372
6 SASI_Hs01_00220622 predicted 369
7 SASI_Hs01_00220623 predicted 357
8 SASI_Hs01_00220624 predicted 372
9 SASI_Hs01_00220625 predicted 356
10 SASI_Hs01_00220626 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062135 predicted 692
2 SASI_Hs01_00062137 predicted 383
3 SASI_Hs01_00062138 predicted 921
4 SASI_Hs01_00062139 predicted 182
5 SASI_Hs01_00062140 predicted 137
6 SASI_Hs01_00062141 predicted 259
7 SASI_Hs01_00062142 predicted 761
8 SASI_Hs01_00062143 predicted 375
9 SASI_Hs01_00062144 predicted 204
10 SASI_Hs02_00308855 predicted 347
11 SASI_Hs01_00062136 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253463 predicted 1861
2 SASI_Rn02_00253464 predicted 1848
3 SASI_Rn02_00253465 predicted 928
4 SASI_Rn02_00253466 predicted 1949
5 SASI_Rn02_00253467 predicted 1222
6 SASI_Rn02_00253468 predicted 579
7 SASI_Rn02_00253469 predicted 1821
8 SASI_Rn02_00253470 predicted 812
9 SASI_Rn02_00253471 predicted 1090
10 SASI_Rn02_00253472 predicted 1778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091364 predicted 595
2 SASI_Mm01_00091365 predicted 594
3 SASI_Mm01_00091366 predicted 270
4 SASI_Mm01_00091367 predicted 683
5 SASI_Mm01_00091368 predicted 207
6 SASI_Mm01_00091370 predicted 762
7 SASI_Mm01_00091371 predicted 283
8 SASI_Mm01_00091372 predicted 916
9 SASI_Mm01_00091373 predicted 231
10 SASI_Mm02_00340746 predicted 524
11 SASI_Mm01_00091369 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001002847
VALIDATED
CHTF8 MISSION shRNA Bacterial Glycerol Stock
CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-2226s1c1
Sequence:CCGGGCCCATTGTTTCTTACTAGTTCTCGAGAACTAGTAAGAAACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-1360s1c1
Sequence:CCGGCAAATCCATCTCCCATGTCAACTCGAGTTGACATGGGAGATGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-1240s1c1
Sequence:CCGGCAGCTTCTTTCTCACAGGCTTCTCGAGAAGCCTGTGAGAAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-939s1c1
Sequence:CCGGGTTCTGTTAACCTCTGGGAATCTCGAGATTCCCAGAGGTTAACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002847.1-2062s1c1
Sequence:CCGGGCTCAAGTTCAAATGAGCCATCTCGAGATGGCTCATTTGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001002847
VALIDATED
CHTF8 MISSION shRNA shRNA Plasmid DNA
CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-2226s1c1
Sequence:CCGGGCCCATTGTTTCTTACTAGTTCTCGAGAACTAGTAAGAAACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-1360s1c1
Sequence:CCGGCAAATCCATCTCCCATGTCAACTCGAGTTGACATGGGAGATGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-1240s1c1
Sequence:CCGGCAGCTTCTTTCTCACAGGCTTCTCGAGAAGCCTGTGAGAAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-939s1c1
Sequence:CCGGGTTCTGTTAACCTCTGGGAATCTCGAGATTCCCAGAGGTTAACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002847.1-2062s1c1
Sequence:CCGGGCTCAAGTTCAAATGAGCCATCTCGAGATGGCTCATTTGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001002847
VALIDATED
CHTF8 MISSION shRNA Lentiviral Transduction Particles
CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183356    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-2226s1c1
Sequence:CCGGGCCCATTGTTTCTTACTAGTTCTCGAGAACTAGTAAGAAACAATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-1360s1c1
Sequence:CCGGCAAATCCATCTCCCATGTCAACTCGAGTTGACATGGGAGATGGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-1240s1c1
Sequence:CCGGCAGCTTCTTTCTCACAGGCTTCTCGAGAAGCCTGTGAGAAAGAAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001002847.1-939s1c1
Sequence:CCGGGTTCTGTTAACCTCTGGGAATCTCGAGATTCCCAGAGGTTAACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179434    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001002847.1-2062s1c1
Sequence:CCGGGCTCAAGTTCAAATGAGCCATCTCGAGATGGCTCATTTGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145412
VALIDATED
CHTF8 MISSION shRNA Bacterial Glycerol Stock
CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145412.2-1096s1c1
Sequence:CCGGCAAGTCCAAATCTGAGATCAACTCGAGTTGATCTCAGATTTGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145412.2-2733s1c1
Sequence:CCGGCTCCCAATCAAAGAACCTCAACTCGAGTTGAGGTTCTTTGATTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-237s21c1
Sequence:CCGGCCTCCTGGGAGACCTACATTACTCGAGTAATGTAGGTCTCCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-1078s21c1
Sequence:CCGGGTCCTGGACCAAGTCCAAATCCTCGAGGATTTGGACTTGGTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-409s21c1
Sequence:CCGGTTGGTGACAGCACTCATCAAACTCGAGTTTGATGAGTGCTGTCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-279s21c1
Sequence:CCGGGCTGATCGTGGGCCATCATATCTCGAGATATGATGGCCCACGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-208s21c1
Sequence:CCGGGCTCGCTACAGCACCGGATTACTCGAGTAATCCGGTGCTGTAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145412
VALIDATED
CHTF8 MISSION shRNA shRNA Plasmid DNA
CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145412.2-1096s1c1
Sequence:CCGGCAAGTCCAAATCTGAGATCAACTCGAGTTGATCTCAGATTTGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145412.2-2733s1c1
Sequence:CCGGCTCCCAATCAAAGAACCTCAACTCGAGTTGAGGTTCTTTGATTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-237s21c1
Sequence:CCGGCCTCCTGGGAGACCTACATTACTCGAGTAATGTAGGTCTCCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-1078s21c1
Sequence:CCGGGTCCTGGACCAAGTCCAAATCCTCGAGGATTTGGACTTGGTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-409s21c1
Sequence:CCGGTTGGTGACAGCACTCATCAAACTCGAGTTTGATGAGTGCTGTCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-279s21c1
Sequence:CCGGGCTGATCGTGGGCCATCATATCTCGAGATATGATGGCCCACGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-208s21c1
Sequence:CCGGGCTCGCTACAGCACCGGATTACTCGAGTAATCCGGTGCTGTAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145412
VALIDATED
CHTF8 MISSION shRNA Lentiviral Transduction Particles
CTF8, chromosome transmission fidelity factor 8 homolog (S. cerevisiae)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200659    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145412.2-1096s1c1
Sequence:CCGGCAAGTCCAAATCTGAGATCAACTCGAGTTGATCTCAGATTTGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192352    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145412.2-2733s1c1
Sequence:CCGGCTCCCAATCAAAGAACCTCAACTCGAGTTGAGGTTCTTTGATTGGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-237s21c1
Sequence:CCGGCCTCCTGGGAGACCTACATTACTCGAGTAATGTAGGTCTCCCAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-1078s21c1
Sequence:CCGGGTCCTGGACCAAGTCCAAATCCTCGAGGATTTGGACTTGGTCCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-409s21c1
Sequence:CCGGTTGGTGACAGCACTCATCAAACTCGAGTTTGATGAGTGCTGTCACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264480    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-279s21c1
Sequence:CCGGGCTGATCGTGGGCCATCATATCTCGAGATATGATGGCCCACGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_145412.3-208s21c1
Sequence:CCGGGCTCGCTACAGCACCGGATTACTCGAGTAATCCGGTGCTGTAGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks