EMAIL THIS PAGE TO A FRIEND

CHTOP

chromatin target of PRMT1

83 Gene Product Result for
Synonyms: C1orf77 FL-SRAG FOP RP1-178F15.2 SRAG SRAG-3 SRAG-5 pp7704
Gene ID:
Human(26097) Summary: This gene encodes a small nuclear protein that is characterized by a arginine and glycine rich region. The encoded protein may be involved in cell cycle progression. This protein interacts with protein arginine methyltransferases and plays a role in the activation of estradiol-dependent transcription. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Mouse(66511) chromatin target of PRMT1
Rat(361990) similar to DKFZP547E1010 protein
Rat(500378) chromatin target of PRMT1
chicken(426357) chromatin target of PRMT1
dog(480140) chromatin target of PRMT1
cow(616638) chromatin target of PRMT1
domestic cat(101081438) chromatin target of PRMT1
naked mole-rat(101715719) chromatin target of PRMT1
domestic guinea pig(100725767) chromatin target of PRMT1
sheep(101106216) chromatin target of PRMT1
Domestic Rabbit(100340456) chromatin target of PRMT1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023215 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023215 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023215 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015607 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015607 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015607 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015607 Rosetta Predictions human pricing
NM_001014175 Rosetta Predictions rat pricing
XM_001068792 Rosetta Predictions rat pricing
XM_575736 Rosetta Predictions rat pricing
NM_023215 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015607 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348202 predicted 357
2 SASI_Hs01_00078492 predicted 439
3 SASI_Hs01_00078493 predicted 351
4 SASI_Hs01_00078494 predicted 955
5 SASI_Hs01_00078495 predicted 360
6 SASI_Hs01_00078496 predicted 350
7 SASI_Hs01_00078497 predicted 373
8 SASI_Hs01_00078498 predicted 962
9 SASI_Hs01_00078499 predicted 439
10 SASI_Hs01_00078500 predicted 954
11 SASI_Hs01_00078501 predicted 352
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014175 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032471 predicted 904
2 SASI_Rn01_00032472 predicted 325
3 SASI_Rn01_00032473 predicted 1126
4 SASI_Rn01_00032474 predicted 1029
5 SASI_Rn01_00032475 predicted 919
6 SASI_Rn01_00032477 predicted 316
7 SASI_Rn01_00032478 predicted 339
8 SASI_Rn01_00032479 predicted 575
9 SASI_Rn02_00201671 predicted 973
10 SASI_Rn02_00201672 predicted 520
11 SASI_Rn01_00032476 predicted 1095
12 SASI_Rn01_00032480 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068792 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325876 predicted 673
2 SASI_Rn02_00325877 predicted 324
3 SASI_Rn02_00325878 predicted 670
4 SASI_Rn02_00325879 predicted 1006
5 SASI_Rn02_00325880 predicted 324
6 SASI_Rn02_00325881 predicted 341
7 SASI_Rn02_00325882 predicted 586
8 SASI_Rn02_00325883 predicted 581
9 SASI_Rn02_00325884 predicted 893
10 SASI_Rn02_00325885 predicted 1007
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575736 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404203 predicted 671
2 SASI_Rn02_00404204 predicted 320
3 SASI_Rn02_00404205 predicted 671
4 SASI_Rn02_00404206 predicted 1007
5 SASI_Rn02_00404207 predicted 331
6 SASI_Rn02_00404208 predicted 346
7 SASI_Rn02_00404209 predicted 584
8 SASI_Rn02_00404210 predicted 589
9 SASI_Rn02_00404211 predicted 897
10 SASI_Rn02_00404212 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023215 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326962 predicted 2319
2 SASI_Mm02_00326963 predicted 2335
3 SASI_Mm02_00326964 predicted 2317
4 SASI_Mm02_00326965 predicted 2704
5 SASI_Mm02_00326966 predicted 2546
6 SASI_Mm02_00326967 predicted 2475
7 SASI_Mm02_00326968 predicted 2794
8 SASI_Mm02_00326969 predicted 2499
9 SASI_Mm02_00326970 predicted 2607
10 SASI_Mm02_00326971 predicted 2336
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023215
CHTOP MISSION shRNA Bacterial Glycerol Stock
chromatin target of PRMT1
Mouse
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023215.5-2207s21c1
Sequence:CCGGCAACCAATTGGATGCATACATCTCGAGATGTATGCATCCAATTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023215.5-1787s21c1
Sequence:CCGGGCGCCTGGGTAAGAGTAATATCTCGAGATATTACTCTTACCCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023215.5-2244s21c1
Sequence:CCGGCACCTGGATGCTGAATTGGATCTCGAGATCCAATTCAGCATCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023215.5-2611s21c1
Sequence:CCGGCCTGTCATATACTCTTGACATCTCGAGATGTCAAGAGTATATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2254s1c1
Sequence:CCGGGCTGAATTGGATGCCTACATGCTCGAGCATGTAGGCATCCAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2278s1c1
Sequence:CCGGCAGACAGATCCTGAAACCAATCTCGAGATTGGTTTCAGGATCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200242    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023215.3-2323s1c1
Sequence:CCGGCCTGCCTGTTAGACTCTTGTTCTCGAGAACAAGAGTCTAACAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2203s1c1
Sequence:CCGGCTGGACAACCAATTGGATGCACTCGAGTGCATCCAATTGGTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023215.3-2208s1c1
Sequence:CCGGCAACCAATTGGATGCATACATCTCGAGATGTATGCATCCAATTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023215.3-2612s1c1
Sequence:CCGGCCTGTCATATACTCTTGACATCTCGAGATGTCAAGAGTATATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2282s1c1
Sequence:CCGGCAGATCCTGAAACCAATGATTCTCGAGAATCATTGGTTTCAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023215.3-2245s1c1
Sequence:CCGGCACCTGGATGCTGAATTGGATCTCGAGATCCAATTCAGCATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023215.3-2747s1c1
Sequence:CCGGGCTGGAGCTAAAGGTGTGTTTCTCGAGAAACACACCTTTAGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023215.3-1788s1c1
Sequence:CCGGGCGCCTGGGTAAGAGTAATATCTCGAGATATTACTCTTACCCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-1698s1c1
Sequence:CCGGCAGTGCCAGAAACAGAAGACTCTCGAGAGTCTTCTGTTTCTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-1726s1c1
Sequence:CCGGCAGATGGAGAATAGACCCTCTCTCGAGAGAGGGTCTATTCTCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023215
CHTOP MISSION shRNA shRNA Plasmid DNA
chromatin target of PRMT1
Mouse
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023215.5-2207s21c1
Sequence:CCGGCAACCAATTGGATGCATACATCTCGAGATGTATGCATCCAATTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023215.5-1787s21c1
Sequence:CCGGGCGCCTGGGTAAGAGTAATATCTCGAGATATTACTCTTACCCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023215.5-2244s21c1
Sequence:CCGGCACCTGGATGCTGAATTGGATCTCGAGATCCAATTCAGCATCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023215.5-2611s21c1
Sequence:CCGGCCTGTCATATACTCTTGACATCTCGAGATGTCAAGAGTATATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2254s1c1
Sequence:CCGGGCTGAATTGGATGCCTACATGCTCGAGCATGTAGGCATCCAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2278s1c1
Sequence:CCGGCAGACAGATCCTGAAACCAATCTCGAGATTGGTTTCAGGATCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200242    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023215.3-2323s1c1
Sequence:CCGGCCTGCCTGTTAGACTCTTGTTCTCGAGAACAAGAGTCTAACAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2203s1c1
Sequence:CCGGCTGGACAACCAATTGGATGCACTCGAGTGCATCCAATTGGTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023215.3-2208s1c1
Sequence:CCGGCAACCAATTGGATGCATACATCTCGAGATGTATGCATCCAATTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023215.3-2612s1c1
Sequence:CCGGCCTGTCATATACTCTTGACATCTCGAGATGTCAAGAGTATATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2282s1c1
Sequence:CCGGCAGATCCTGAAACCAATGATTCTCGAGAATCATTGGTTTCAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023215.3-2245s1c1
Sequence:CCGGCACCTGGATGCTGAATTGGATCTCGAGATCCAATTCAGCATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023215.3-2747s1c1
Sequence:CCGGGCTGGAGCTAAAGGTGTGTTTCTCGAGAAACACACCTTTAGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023215.3-1788s1c1
Sequence:CCGGGCGCCTGGGTAAGAGTAATATCTCGAGATATTACTCTTACCCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-1698s1c1
Sequence:CCGGCAGTGCCAGAAACAGAAGACTCTCGAGAGTCTTCTGTTTCTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-1726s1c1
Sequence:CCGGCAGATGGAGAATAGACCCTCTCTCGAGAGAGGGTCTATTCTCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023215
CHTOP MISSION shRNA Lentiviral Transduction Particles
chromatin target of PRMT1
Mouse
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023215.5-2207s21c1
Sequence:CCGGCAACCAATTGGATGCATACATCTCGAGATGTATGCATCCAATTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345317    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023215.5-1787s21c1
Sequence:CCGGGCGCCTGGGTAAGAGTAATATCTCGAGATATTACTCTTACCCAGGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345249    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023215.5-2244s21c1
Sequence:CCGGCACCTGGATGCTGAATTGGATCTCGAGATCCAATTCAGCATCCAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023215.5-2611s21c1
Sequence:CCGGCCTGTCATATACTCTTGACATCTCGAGATGTCAAGAGTATATGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200390    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2254s1c1
Sequence:CCGGGCTGAATTGGATGCCTACATGCTCGAGCATGTAGGCATCCAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198845    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2278s1c1
Sequence:CCGGCAGACAGATCCTGAAACCAATCTCGAGATTGGTTTCAGGATCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200242    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023215.3-2323s1c1
Sequence:CCGGCCTGCCTGTTAGACTCTTGTTCTCGAGAACAAGAGTCTAACAGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182803    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2203s1c1
Sequence:CCGGCTGGACAACCAATTGGATGCACTCGAGTGCATCCAATTGGTTGTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023215.3-2208s1c1
Sequence:CCGGCAACCAATTGGATGCATACATCTCGAGATGTATGCATCCAATTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178554    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023215.3-2612s1c1
Sequence:CCGGCCTGTCATATACTCTTGACATCTCGAGATGTCAAGAGTATATGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178578    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-2282s1c1
Sequence:CCGGCAGATCCTGAAACCAATGATTCTCGAGAATCATTGGTTTCAGGATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023215.3-2245s1c1
Sequence:CCGGCACCTGGATGCTGAATTGGATCTCGAGATCCAATTCAGCATCCAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182262    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023215.3-2747s1c1
Sequence:CCGGGCTGGAGCTAAAGGTGTGTTTCTCGAGAAACACACCTTTAGCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182440    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023215.3-1788s1c1
Sequence:CCGGGCGCCTGGGTAAGAGTAATATCTCGAGATATTACTCTTACCCAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182748    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-1698s1c1
Sequence:CCGGCAGTGCCAGAAACAGAAGACTCTCGAGAGTCTTCTGTTTCTGGCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023215.3-1726s1c1
Sequence:CCGGCAGATGGAGAATAGACCCTCTCTCGAGAGAGGGTCTATTCTCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015607
CHTOP MISSION shRNA Bacterial Glycerol Stock
chromatin target of PRMT1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000121881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015607.2-1090s1c1
Sequence:CCGGGTTAGTCAACACATCTGTAAACTCGAGTTTACAGATGTGTTGACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015607.2-360s1c1
Sequence:CCGGGATGTCTCTAAATGAGCGCTTCTCGAGAAGCGCTCATTTAGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015607.2-754s1c1
Sequence:CCGGCGAATGGGCTTAAGAAGAGGTCTCGAGACCTCTTCTTAAGCCCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015607.2-486s1c1
Sequence:CCGGGATGGAGAATAGACCCTCTGTCTCGAGACAGAGGGTCTATTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015607.2-350s1c1
Sequence:CCGGGCACCACCAAGATGTCTCTAACTCGAGTTAGAGACATCTTGGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015607.2-955s1c1
Sequence:CCGGCAGCTGGACAACCAATTGGATCTCGAGATCCAATTGGTTGTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015607.2-1083s1c1
Sequence:CCGGGACTCTTGTTAGTCAACACATCTCGAGATGTGTTGACTAACAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015607.2-354s1c1
Sequence:CCGGCACCAAGATGTCTCTAAATGACTCGAGTCATTTAGAGACATCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015607.2-1135s1c1
Sequence:CCGGGAAATCTGATTGATGCTGGATCTCGAGATCCAGCATCAATCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015607
CHTOP MISSION shRNA shRNA Plasmid DNA
chromatin target of PRMT1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000121881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015607.2-1090s1c1
Sequence:CCGGGTTAGTCAACACATCTGTAAACTCGAGTTTACAGATGTGTTGACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015607.2-360s1c1
Sequence:CCGGGATGTCTCTAAATGAGCGCTTCTCGAGAAGCGCTCATTTAGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015607.2-754s1c1
Sequence:CCGGCGAATGGGCTTAAGAAGAGGTCTCGAGACCTCTTCTTAAGCCCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015607.2-486s1c1
Sequence:CCGGGATGGAGAATAGACCCTCTGTCTCGAGACAGAGGGTCTATTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015607.2-350s1c1
Sequence:CCGGGCACCACCAAGATGTCTCTAACTCGAGTTAGAGACATCTTGGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015607.2-955s1c1
Sequence:CCGGCAGCTGGACAACCAATTGGATCTCGAGATCCAATTGGTTGTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015607.2-1083s1c1
Sequence:CCGGGACTCTTGTTAGTCAACACATCTCGAGATGTGTTGACTAACAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015607.2-354s1c1
Sequence:CCGGCACCAAGATGTCTCTAAATGACTCGAGTCATTTAGAGACATCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015607.2-1135s1c1
Sequence:CCGGGAAATCTGATTGATGCTGGATCTCGAGATCCAGCATCAATCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015607
CHTOP MISSION shRNA Lentiviral Transduction Particles
chromatin target of PRMT1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000121881    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015607.2-1090s1c1
Sequence:CCGGGTTAGTCAACACATCTGTAAACTCGAGTTTACAGATGTGTTGACTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015607.2-360s1c1
Sequence:CCGGGATGTCTCTAAATGAGCGCTTCTCGAGAAGCGCTCATTTAGAGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139775    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015607.2-754s1c1
Sequence:CCGGCGAATGGGCTTAAGAAGAGGTCTCGAGACCTCTTCTTAAGCCCATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015607.2-486s1c1
Sequence:CCGGGATGGAGAATAGACCCTCTGTCTCGAGACAGAGGGTCTATTCTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015607.2-350s1c1
Sequence:CCGGGCACCACCAAGATGTCTCTAACTCGAGTTAGAGACATCTTGGTGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015607.2-955s1c1
Sequence:CCGGCAGCTGGACAACCAATTGGATCTCGAGATCCAATTGGTTGTCCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145387    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015607.2-1083s1c1
Sequence:CCGGGACTCTTGTTAGTCAACACATCTCGAGATGTGTTGACTAACAAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015607.2-354s1c1
Sequence:CCGGCACCAAGATGTCTCTAAATGACTCGAGTCATTTAGAGACATCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145201    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015607.2-1135s1c1
Sequence:CCGGGAAATCTGATTGATGCTGGATCTCGAGATCCAGCATCAATCAGATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks