EMAIL THIS PAGE TO A FRIEND

CHUK

conserved helix-loop-helix ubiquitous kinase

185 Gene Product Result for
Synonyms: IKBKA IKK-alpha IKK1 IKKA NFKBIKA TCF16
UniProtKB ID: O15111, O14666, Q13132, Q5W0I4, Q92467
Gene ID:
Human(1147) Summary: This gene encodes a member of the serine/threonine protein kinase family. The encoded protein, a component of a cytokine-activated protein complex that is an inhibitor of the essential transcription factor NF-kappa-B complex, phosphorylates sites that trigger the degradation of the inhibitor via the ubiquination pathway, thereby activating the transcription factor. [provided by RefSeq, Jul 2008]
Mouse(12675) conserved helix-loop-helix ubiquitous kinase
Rat(309361) conserved helix-loop-helix ubiquitous kinase
Zebrafish(393287) conserved helix-loop-helix ubiquitous kinase
cow(281073) conserved helix-loop-helix ubiquitous kinase
Horse(100070393) conserved helix-loop-helix ubiquitous kinase
dog(477796) conserved helix-loop-helix ubiquitous kinase
chicken(423669) conserved helix-loop-helix ubiquitous kinase
domestic cat(101095617) conserved helix-loop-helix ubiquitous kinase
sheep(101111143) conserved helix-loop-helix ubiquitous kinase
domestic guinea pig(100726357) conserved helix-loop-helix ubiquitous kinase
naked mole-rat(101719306) conserved helix-loop-helix ubiquitous kinase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300396 Anti-CHUK (Ab-23) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
GW21170 Anti-CHUK antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
SAB1412404 ANTI-CHUK antibody produced in mouse clone 4D11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412405 ANTI-CHUK antibody produced in mouse clone 1F8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA001402 Anti-CHUK antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1305912 ANTI-IKK ALPHA/IKK BETA (CENTER) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4500257 Anti-IKK-α antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500258 Anti-IKK-α antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4500259 Anti-IKK-α, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
I7778 Anti-IKKα (699-715) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
I7903 Anti-IKKα (716-734) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1300466 Anti-IKKα antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, western blot pricing
I9767 Anti-IKKβ antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4300106 Anti-phospho-CHUK (pThr23) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4503882 Anti-phospho-IKK-α (pSer176) /IKK-β (pSer177) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504439 Anti-phospho-IKK-α (pThr23) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301430 Anti-phospho-IKK-α/β (pSer176/177) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB4503881 Anti-phospho-IKK-α/β (pSer180/181) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301429 Anti-phospho-IKK-α/β (pSer180/181) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
WH0001147M3 Monoclonal Anti-CHUK antibody produced in mouse clone 4B8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB5300491 Monoclonal Anti-CHUK antibody produced in mouse clone 7C10B6, ascites fluid human
ELISA, western blot pricing
SAB5300492 Monoclonal Anti-CHUK antibody produced in mouse clone 3G12, ascites fluid human
ELISA, western blot pricing
SAB5300493 Monoclonal Anti-CHUK antibody produced in mouse clone 3G12H9, ascites fluid human
ELISA, flow cytometry, immunofluorescence, western blot pricing
SAB1403670 Monoclonal Anti-CHUK, (C-terminal) antibody produced in mouse clone 2G4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0224 Rabbit anti-IKK-alpha Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, rat, horse, rhesus monkey, marmoset, guinea pig, mouse, chimpanzee, rabbit, primate, dog, gorilla
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001278 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001278 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001278 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007700 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007700 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007700 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001278 siRNAs that have been validated in the lab human pricing
NM_001107588 Rosetta Predictions rat pricing
NM_007700 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001278 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206921 validated 1699
1 SASI_Hs01_00206923 validated 1949
1 SASI_WI_00000021 validated 1402
1 SASI_Hs01_00206922 validated 732
1 SASI_WI_00000019 validated 2756
2 SASI_Hs02_00331498 predicted 1892
3 SASI_Hs02_00331499 predicted 1509
4 SASI_Hs01_00206924 predicted 443
5 SASI_Hs01_00206925 predicted 1611
6 SASI_Hs01_00206926 predicted 2381
7 SASI_Hs01_00206927 predicted 1304
8 SASI_Hs01_00206928 predicted 1249
9 SASI_Hs01_00206930 predicted 2061
10 SASI_Hs01_00206929 predicted 1392
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107588 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230315 predicted 956
2 SASI_Rn02_00230316 predicted 1385
3 SASI_Rn02_00230317 predicted 216
4 SASI_Rn02_00230318 predicted 2251
5 SASI_Rn02_00230319 predicted 2041
6 SASI_Rn02_00230320 predicted 2288
7 SASI_Rn02_00230321 predicted 476
8 SASI_Rn02_00230322 predicted 872
9 SASI_Rn02_00230323 predicted 801
10 SASI_Rn02_00230324 predicted 1989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007700 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169873 predicted 1708
2 SASI_Mm01_00169874 predicted 1991
3 SASI_Mm01_00169875 predicted 1622
4 SASI_Mm02_00312260 predicted 992
5 SASI_Mm01_00169878 predicted 2248
6 SASI_Mm01_00169879 predicted 1182
7 SASI_Mm01_00169880 predicted 411
8 SASI_Mm01_00169881 predicted 1600
9 SASI_Mm01_00169882 predicted 1248
10 SASI_Mm02_00312261 predicted 753
11 SASI_Mm01_00169876 predicted 2209
12 SASI_Mm01_00169877 predicted 1782
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001278
VALIDATED
CHUK MISSION shRNA Bacterial Glycerol Stock
conserved helix-loop-helix ubiquitous kinase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000000504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001278.x-2866s1c1
Sequence:CCGGGCATCATAAGGAGTTGGTGTACTCGAGTACACCAACTCCTTATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001278.x-2274s1c1
Sequence:CCGGGCAAATGAGGAACAGGGCAATCTCGAGATTGCCCTGTTCCTCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001278.x-1781s1c1
Sequence:CCGGGCGTGCCATTGATCTATATAACTCGAGTTATATAGATCAATGGCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-1543s1c1
Sequence:CCGGGCAGATGACGTATGGGATATCCTCGAGGATATCCCATACGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-412s1c1
Sequence:CCGGCCAGATACTTTCTTTACTAAGCTCGAGCTTAGTAAAGAAAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-2753s1c1
Sequence:CCGGGCTGCTCACAAGTTCTATTTCCTCGAGGAAATAGAACTTGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001278.3-1738s21c1
Sequence:CCGGACAGCGTGCCATTGATCTATACTCGAGTATAGATCAATGGCACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001278.3-691s21c1
Sequence:CCGGTGAATGTATTGCTGGATATAGCTCGAGCTATATCCAGCAATACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001278.3-2206s21c1
Sequence:CCGGTGGCCATTTAAGCACTATTATCTCGAGATAATAGTGCTTAAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-2206s1c1
Sequence:CCGGTGGCCATTTAAGCACTATTATCTCGAGATAATAGTGCTTAAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-438s1c1
Sequence:CCGGTAGGGTCTGGGATTCGATATTCTCGAGAATATCGAATCCCAGACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001278.3-3312s21c1
Sequence:CCGGGGTTAATGTAGTATGGTATATCTCGAGATATACCATACTACATTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001278
VALIDATED
CHUK MISSION shRNA shRNA Plasmid DNA
conserved helix-loop-helix ubiquitous kinase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000000504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001278.x-2866s1c1
Sequence:CCGGGCATCATAAGGAGTTGGTGTACTCGAGTACACCAACTCCTTATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001278.x-2274s1c1
Sequence:CCGGGCAAATGAGGAACAGGGCAATCTCGAGATTGCCCTGTTCCTCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001278.x-1781s1c1
Sequence:CCGGGCGTGCCATTGATCTATATAACTCGAGTTATATAGATCAATGGCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-1543s1c1
Sequence:CCGGGCAGATGACGTATGGGATATCCTCGAGGATATCCCATACGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-412s1c1
Sequence:CCGGCCAGATACTTTCTTTACTAAGCTCGAGCTTAGTAAAGAAAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-2753s1c1
Sequence:CCGGGCTGCTCACAAGTTCTATTTCCTCGAGGAAATAGAACTTGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001278.3-1738s21c1
Sequence:CCGGACAGCGTGCCATTGATCTATACTCGAGTATAGATCAATGGCACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001278.3-691s21c1
Sequence:CCGGTGAATGTATTGCTGGATATAGCTCGAGCTATATCCAGCAATACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001278.3-2206s21c1
Sequence:CCGGTGGCCATTTAAGCACTATTATCTCGAGATAATAGTGCTTAAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-2206s1c1
Sequence:CCGGTGGCCATTTAAGCACTATTATCTCGAGATAATAGTGCTTAAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-438s1c1
Sequence:CCGGTAGGGTCTGGGATTCGATATTCTCGAGAATATCGAATCCCAGACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001278.3-3312s21c1
Sequence:CCGGGGTTAATGTAGTATGGTATATCTCGAGATATACCATACTACATTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001278
VALIDATED
CHUK MISSION shRNA Lentiviral Transduction Particles
conserved helix-loop-helix ubiquitous kinase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000000504    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001278.x-2866s1c1
Sequence:CCGGGCATCATAAGGAGTTGGTGTACTCGAGTACACCAACTCCTTATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001278.x-2274s1c1
Sequence:CCGGGCAAATGAGGAACAGGGCAATCTCGAGATTGCCCTGTTCCTCATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A3
TRC Version: 1 Clone ID:NM_001278.x-1781s1c1
Sequence:CCGGGCGTGCCATTGATCTATATAACTCGAGTTATATAGATCAATGGCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-1543s1c1
Sequence:CCGGGCAGATGACGTATGGGATATCCTCGAGGATATCCCATACGTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194782    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-412s1c1
Sequence:CCGGCCAGATACTTTCTTTACTAAGCTCGAGCTTAGTAAAGAAAGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196924    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-2753s1c1
Sequence:CCGGGCTGCTCACAAGTTCTATTTCCTCGAGGAAATAGAACTTGTGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001278.3-1738s21c1
Sequence:CCGGACAGCGTGCCATTGATCTATACTCGAGTATAGATCAATGGCACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001278.3-691s21c1
Sequence:CCGGTGAATGTATTGCTGGATATAGCTCGAGCTATATCCAGCAATACATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001278.3-2206s21c1
Sequence:CCGGTGGCCATTTAAGCACTATTATCTCGAGATAATAGTGCTTAAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-2206s1c1
Sequence:CCGGTGGCCATTTAAGCACTATTATCTCGAGATAATAGTGCTTAAATGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_001278.3-438s1c1
Sequence:CCGGTAGGGTCTGGGATTCGATATTCTCGAGAATATCGAATCCCAGACCCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001278.3-3312s21c1
Sequence:CCGGGGTTAATGTAGTATGGTATATCTCGAGATATACCATACTACATTAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007700
VALIDATED
CHUK MISSION shRNA Bacterial Glycerol Stock
conserved helix-loop-helix ubiquitous kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-3246s1c1
Sequence:CCGGGCTCTCTTGAAGGTTGATGTACTCGAGTACATCAACCTTCAAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-1739s1c1
Sequence:CCGGGCGTGCCATTGATCTCTATAACTCGAGTTATAGAGATCAATGGCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-998s1c1
Sequence:CCGGCCTAAATATGACTTCTGCAAACTCGAGTTTGCAGAAGTCATATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-1401s1c1
Sequence:CCGGGCAGCAATGTTAAGTCTTCTTCTCGAGAAGAAGACTTAACATTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-1956s1c1
Sequence:CCGGGCTGACAATACTGTCATGTTTCTCGAGAAACATGACAGTATTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007700.1-1739s21c1
Sequence:CCGGGCGTGCCATTGATCTCTATAACTCGAGTTATAGAGATCAATGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007700.1-1401s21c1
Sequence:CCGGGCAGCAATGTTAAGTCTTCTTCTCGAGAAGAAGACTTAACATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007700.1-1956s21c1
Sequence:CCGGGCTGACAATACTGTCATGTTTCTCGAGAAACATGACAGTATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007700.1-3246s21c1
Sequence:CCGGGCTCTCTTGAAGGTTGATGTACTCGAGTACATCAACCTTCAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007700
VALIDATED
CHUK MISSION shRNA shRNA Plasmid DNA
conserved helix-loop-helix ubiquitous kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-3246s1c1
Sequence:CCGGGCTCTCTTGAAGGTTGATGTACTCGAGTACATCAACCTTCAAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-1739s1c1
Sequence:CCGGGCGTGCCATTGATCTCTATAACTCGAGTTATAGAGATCAATGGCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-998s1c1
Sequence:CCGGCCTAAATATGACTTCTGCAAACTCGAGTTTGCAGAAGTCATATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-1401s1c1
Sequence:CCGGGCAGCAATGTTAAGTCTTCTTCTCGAGAAGAAGACTTAACATTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-1956s1c1
Sequence:CCGGGCTGACAATACTGTCATGTTTCTCGAGAAACATGACAGTATTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007700.1-1739s21c1
Sequence:CCGGGCGTGCCATTGATCTCTATAACTCGAGTTATAGAGATCAATGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007700.1-1401s21c1
Sequence:CCGGGCAGCAATGTTAAGTCTTCTTCTCGAGAAGAAGACTTAACATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007700.1-1956s21c1
Sequence:CCGGGCTGACAATACTGTCATGTTTCTCGAGAAACATGACAGTATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007700.1-3246s21c1
Sequence:CCGGGCTCTCTTGAAGGTTGATGTACTCGAGTACATCAACCTTCAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007700
VALIDATED
CHUK MISSION shRNA Lentiviral Transduction Particles
conserved helix-loop-helix ubiquitous kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012348    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-3246s1c1
Sequence:CCGGGCTCTCTTGAAGGTTGATGTACTCGAGTACATCAACCTTCAAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012352    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-1739s1c1
Sequence:CCGGGCGTGCCATTGATCTCTATAACTCGAGTTATAGAGATCAATGGCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-998s1c1
Sequence:CCGGCCTAAATATGACTTCTGCAAACTCGAGTTTGCAGAAGTCATATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-1401s1c1
Sequence:CCGGGCAGCAATGTTAAGTCTTCTTCTCGAGAAGAAGACTTAACATTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007700.1-1956s1c1
Sequence:CCGGGCTGACAATACTGTCATGTTTCTCGAGAAACATGACAGTATTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297778    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007700.1-1739s21c1
Sequence:CCGGGCGTGCCATTGATCTCTATAACTCGAGTTATAGAGATCAATGGCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007700.1-1401s21c1
Sequence:CCGGGCAGCAATGTTAAGTCTTCTTCTCGAGAAGAAGACTTAACATTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007700.1-1956s21c1
Sequence:CCGGGCTGACAATACTGTCATGTTTCTCGAGAAACATGACAGTATTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007700.1-3246s21c1
Sequence:CCGGGCTCTCTTGAAGGTTGATGTACTCGAGTACATCAACCTTCAAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks