EMAIL THIS PAGE TO A FRIEND

CHURC1

churchill domain containing 1

163 Gene Product Result for
Synonyms: C14orf52 chch
UniProtKB ID: Q8WUH1, B3KQ81, G3V1X3, G3V214, Q9H3K7
Gene ID:
Mouse(211151) churchill domain containing 1
Rat(299154) churchill domain containing 1
Zebrafish(492508) churchill domain containing 1
dog(609942) churchill domain containing 1
chicken(395448) churchill domain containing 1
domestic cat(101089274) churchill domain containing 1
cow(616539) churchill domain containing 1
naked mole-rat(101700823) churchill domain containing 1
domestic guinea pig(100714407) churchill domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145165 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145165 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145165 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_206534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_206534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_206534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050451 MISSION® esiRNA esiRNA human CHURC1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145165 Rosetta Predictions human pricing
NM_001106741 Rosetta Predictions rat pricing
NM_206534 Rosetta Predictions mouse pricing
XM_126982 Rosetta Predictions mouse pricing
XM_898874 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145165 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149938 predicted 251
2 SASI_Hs01_00149939 predicted 234
3 SASI_Hs01_00149940 predicted 272
4 SASI_Hs01_00149941 predicted 261
5 SASI_Hs01_00149942 predicted 274
6 SASI_Hs01_00149943 predicted 219
7 SASI_Hs01_00149944 predicted 416
8 SASI_Hs01_00149945 predicted 585
9 SASI_Hs02_00365011 predicted 476
10 SASI_Hs02_00365012 predicted 554
11 SASI_Hs01_00149946 predicted 134
12 SASI_Hs01_00149947 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106741 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221938 predicted 217
2 SASI_Rn02_00221939 predicted 210
3 SASI_Rn02_00221940 predicted 222
4 SASI_Rn02_00221941 predicted 213
5 SASI_Rn02_00221942 predicted 233
6 SASI_Rn02_00221943 predicted 195
7 SASI_Rn02_00221944 predicted 231
8 SASI_Rn02_00221945 predicted 202
9 SASI_Rn02_00221946 predicted 201
10 SASI_Rn02_00221947 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00351803 predicted 196
2 SASI_Mm02_00351804 predicted 228
3 SASI_Mm02_00351805 predicted 304
4 SASI_Mm02_00351806 predicted 308
5 SASI_Mm02_00351807 predicted 228
6 SASI_Mm02_00351808 predicted 235
7 SASI_Mm02_00351809 predicted 225
8 SASI_Mm02_00351810 predicted 259
9 SASI_Mm02_00351811 predicted 208
10 SASI_Mm02_00351812 predicted 233
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_126982 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00237250 predicted 217
2 SASI_Mm01_00237251 predicted 226
3 SASI_Mm01_00237252 predicted 225
4 SASI_Mm01_00237253 predicted 256
5 SASI_Mm01_00237254 predicted 224
6 SASI_Mm01_00237255 predicted 338
7 SASI_Mm01_00237256 predicted 346
8 SASI_Mm01_00237257 predicted 203
9 SASI_Mm01_00237258 predicted 203
10 SASI_Mm01_00237259 predicted 254
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898874 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208506 predicted 217
2 SASI_Mm01_00208507 predicted 206
3 SASI_Mm01_00208508 predicted 236
4 SASI_Mm01_00208509 predicted 232
5 SASI_Mm01_00208510 predicted 246
6 SASI_Mm01_00208511 predicted 215
7 SASI_Mm01_00208512 predicted 203
8 SASI_Mm01_00208513 predicted 281
9 SASI_Mm01_00208514 predicted 228
10 SASI_Mm01_00208515 predicted 242
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145165
VALIDATED
CHURC1 MISSION shRNA Bacterial Glycerol Stock
churchill domain containing 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-277s21c1
Sequence:CCGGTAATAGCCAGACATGAGTATACTCGAGTATACTCATGTCTGGCTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145165.2-471s21c1
Sequence:CCGGGCCTGATGGTTTGTCTTATTTCTCGAGAAATAAGACAAACCATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-236s21c1
Sequence:CCGGAGTTACCTATGATCCAGATTTCTCGAGAAATCTGGATCATAGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-167s21c1
Sequence:CCGGAGTGTGCAGTAAGCGGGATTTCTCGAGAAATCCCGCTTACTGCACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-115s21c1
Sequence:CCGGGTAATACCTGCCTGGAGAATGCTCGAGCATTCTCCAGGCAGGTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145165.2-558s21c1
Sequence:CCGGAGGTAATGTAGGAGCTCATTGCTCGAGCAATGAGCTCCTACATTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-357s1c1
Sequence:CCGGCGGCAAAGCCGAAGATACTATCTCGAGATAGTATCTTCGGCTTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-333s1c1
Sequence:CCGGGTATACCATGCTGTGTCTGTTCTCGAGAACAGACACAGCATGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-399s1c1
Sequence:CCGGCCGACAAATGACTCTCTTATTCTCGAGAATAAGAGAGTCATTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145165.1-370s1c1
Sequence:CCGGGATACTATCAGTATTCTCCCTCTCGAGAGGGAGAATACTGATAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145165.1-400s1c1
Sequence:CCGGCGACAAATGACTCTCTTATTCCTCGAGGAATAAGAGAGTCATTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-201s1c1
Sequence:CCGGGCTGATCACAAACAAATCCTTCTCGAGAAGGATTTGTTTGTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-364s1c1
Sequence:CCGGGCCGAAGATACTATCAGTATTCTCGAGAATACTGATAGTATCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145165.1-359s1c1
Sequence:CCGGGCAAAGCCGAAGATACTATCACTCGAGTGATAGTATCTTCGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145165
VALIDATED
CHURC1 MISSION shRNA shRNA Plasmid DNA
churchill domain containing 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-277s21c1
Sequence:CCGGTAATAGCCAGACATGAGTATACTCGAGTATACTCATGTCTGGCTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145165.2-471s21c1
Sequence:CCGGGCCTGATGGTTTGTCTTATTTCTCGAGAAATAAGACAAACCATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-236s21c1
Sequence:CCGGAGTTACCTATGATCCAGATTTCTCGAGAAATCTGGATCATAGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-167s21c1
Sequence:CCGGAGTGTGCAGTAAGCGGGATTTCTCGAGAAATCCCGCTTACTGCACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-115s21c1
Sequence:CCGGGTAATACCTGCCTGGAGAATGCTCGAGCATTCTCCAGGCAGGTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145165.2-558s21c1
Sequence:CCGGAGGTAATGTAGGAGCTCATTGCTCGAGCAATGAGCTCCTACATTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-357s1c1
Sequence:CCGGCGGCAAAGCCGAAGATACTATCTCGAGATAGTATCTTCGGCTTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-333s1c1
Sequence:CCGGGTATACCATGCTGTGTCTGTTCTCGAGAACAGACACAGCATGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-399s1c1
Sequence:CCGGCCGACAAATGACTCTCTTATTCTCGAGAATAAGAGAGTCATTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145165.1-370s1c1
Sequence:CCGGGATACTATCAGTATTCTCCCTCTCGAGAGGGAGAATACTGATAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145165.1-400s1c1
Sequence:CCGGCGACAAATGACTCTCTTATTCCTCGAGGAATAAGAGAGTCATTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-201s1c1
Sequence:CCGGGCTGATCACAAACAAATCCTTCTCGAGAAGGATTTGTTTGTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-364s1c1
Sequence:CCGGGCCGAAGATACTATCAGTATTCTCGAGAATACTGATAGTATCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145165.1-359s1c1
Sequence:CCGGGCAAAGCCGAAGATACTATCACTCGAGTGATAGTATCTTCGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145165
VALIDATED
CHURC1 MISSION shRNA Lentiviral Transduction Particles
churchill domain containing 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-277s21c1
Sequence:CCGGTAATAGCCAGACATGAGTATACTCGAGTATACTCATGTCTGGCTATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145165.2-471s21c1
Sequence:CCGGGCCTGATGGTTTGTCTTATTTCTCGAGAAATAAGACAAACCATCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-236s21c1
Sequence:CCGGAGTTACCTATGATCCAGATTTCTCGAGAAATCTGGATCATAGGTAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-167s21c1
Sequence:CCGGAGTGTGCAGTAAGCGGGATTTCTCGAGAAATCCCGCTTACTGCACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426008    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145165.2-115s21c1
Sequence:CCGGGTAATACCTGCCTGGAGAATGCTCGAGCATTCTCCAGGCAGGTATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145165.2-558s21c1
Sequence:CCGGAGGTAATGTAGGAGCTCATTGCTCGAGCAATGAGCTCCTACATTACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155441    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-357s1c1
Sequence:CCGGCGGCAAAGCCGAAGATACTATCTCGAGATAGTATCTTCGGCTTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153139    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-333s1c1
Sequence:CCGGGTATACCATGCTGTGTCTGTTCTCGAGAACAGACACAGCATGGTATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-399s1c1
Sequence:CCGGCCGACAAATGACTCTCTTATTCTCGAGAATAAGAGAGTCATTTGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145165.1-370s1c1
Sequence:CCGGGATACTATCAGTATTCTCCCTCTCGAGAGGGAGAATACTGATAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145165.1-400s1c1
Sequence:CCGGCGACAAATGACTCTCTTATTCCTCGAGGAATAAGAGAGTCATTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-201s1c1
Sequence:CCGGGCTGATCACAAACAAATCCTTCTCGAGAAGGATTTGTTTGTGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145165.1-364s1c1
Sequence:CCGGGCCGAAGATACTATCAGTATTCTCGAGAATACTGATAGTATCTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152884    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145165.1-359s1c1
Sequence:CCGGGCAAAGCCGAAGATACTATCACTCGAGTGATAGTATCTTCGGCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_206534
VALIDATED
CHURC1 MISSION shRNA Bacterial Glycerol Stock
churchill domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-122s21c1
Sequence:CCGGTGTGCAGTAAGCGGGACTTTACTCGAGTAAAGTCCCGCTTACTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-307s21c1
Sequence:CCGGGCTGAAGATACTATCAGTATTCTCGAGAATACTGATAGTATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-80s21c1
Sequence:CCGGTGGAGAATGGATCGTTCTTACCTCGAGGTAAGAACGATCCATTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-386s21c1
Sequence:CCGGTAACTGTGTTGGCTTGCTTTACTCGAGTAAAGCAAGCCAACACAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-227s21c1
Sequence:CCGGTAGTAGCCAGACACGAGTATACTCGAGTATACTCGTGTCTGGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_206534
VALIDATED
CHURC1 MISSION shRNA shRNA Plasmid DNA
churchill domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-122s21c1
Sequence:CCGGTGTGCAGTAAGCGGGACTTTACTCGAGTAAAGTCCCGCTTACTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-307s21c1
Sequence:CCGGGCTGAAGATACTATCAGTATTCTCGAGAATACTGATAGTATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-80s21c1
Sequence:CCGGTGGAGAATGGATCGTTCTTACCTCGAGGTAAGAACGATCCATTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-386s21c1
Sequence:CCGGTAACTGTGTTGGCTTGCTTTACTCGAGTAAAGCAAGCCAACACAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-227s21c1
Sequence:CCGGTAGTAGCCAGACACGAGTATACTCGAGTATACTCGTGTCTGGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_206534
VALIDATED
CHURC1 MISSION shRNA Lentiviral Transduction Particles
churchill domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241621    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-122s21c1
Sequence:CCGGTGTGCAGTAAGCGGGACTTTACTCGAGTAAAGTCCCGCTTACTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241618    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-307s21c1
Sequence:CCGGGCTGAAGATACTATCAGTATTCTCGAGAATACTGATAGTATCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-80s21c1
Sequence:CCGGTGGAGAATGGATCGTTCTTACCTCGAGGTAAGAACGATCCATTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241619    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-386s21c1
Sequence:CCGGTAACTGTGTTGGCTTGCTTTACTCGAGTAAAGCAAGCCAACACAGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_206534.1-227s21c1
Sequence:CCGGTAGTAGCCAGACACGAGTATACTCGAGTATACTCGTGTCTGGCTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks