EMAIL THIS PAGE TO A FRIEND

CIAO1

cytosolic iron-sulfur protein assembly 1

61 Gene Product Result for
Synonyms: CIA1 WDR39
UniProtKB ID: O76071, A0MNN9, Q53FM5
Gene ID:
Mouse(26371) cytosolic iron-sulfur protein assembly 1
Rat(29231) cytosolic iron-sulfur protein assembly 1
naked mole-rat(101703455) cytosolic iron-sulfur protein assembly 1
domestic guinea pig(100713472) cytosolic iron-sulfur protein assembly 1
sheep(101113574) cytosolic iron-sulfur protein assembly 1
Zebrafish(795104) cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae)
chicken(426332) cytosolic iron-sulfur protein assembly 1
cow(540069) cytosolic iron-sulfur protein assembly 1
Horse(100062424) cytosolic iron-sulfur protein assembly 1
domestic cat(101091438) cytosolic iron-sulfur protein assembly 1
dog(475743) cytosolic iron-sulfur protein assembly 1
fruit fly(36655) CG12797 gene product from transcript CG12797-RA
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004804 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004804 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004804 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004804 Rosetta Predictions human pricing
NM_001008766 Rosetta Predictions rat pricing
NM_025296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004804 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171629 predicted 1493
2 SASI_Hs01_00171630 predicted 485
3 SASI_Hs01_00171631 predicted 1423
4 SASI_Hs01_00171632 predicted 691
5 SASI_Hs01_00171633 predicted 1420
6 SASI_Hs01_00171635 predicted 864
7 SASI_Hs01_00171636 predicted 1227
8 SASI_Hs01_00171637 predicted 577
9 SASI_Hs01_00171638 predicted 1453
10 SASI_Hs02_00338348 predicted 834
11 SASI_Hs01_00171634 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008766 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199274 predicted 1171
2 SASI_Rn01_00056514 predicted 882
3 SASI_Rn01_00056516 predicted 319
4 SASI_Rn02_00199275 predicted 737
5 SASI_Rn01_00056517 predicted 846
6 SASI_Rn01_00056518 predicted 305
7 SASI_Rn01_00056519 predicted 354
8 SASI_Rn01_00056520 predicted 376
9 SASI_Rn01_00056521 predicted 789
10 SASI_Rn01_00056522 predicted 570
11 SASI_Rn01_00056515 predicted 746
12 SASI_Rn01_00056523 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070042 predicted 936
2 SASI_Mm01_00070043 predicted 555
3 SASI_Mm01_00070044 predicted 784
4 SASI_Mm01_00070045 predicted 398
5 SASI_Mm01_00070046 predicted 701
6 SASI_Mm02_00327911 predicted 416
7 SASI_Mm01_00070048 predicted 1134
8 SASI_Mm01_00070049 predicted 622
9 SASI_Mm01_00070050 predicted 489
10 SASI_Mm02_00327912 predicted 754
11 SASI_Mm01_00070047 predicted 845
12 SASI_Mm01_00070051 predicted 640
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025296
VALIDATED
CIAO1 MISSION shRNA Bacterial Glycerol Stock
cytosolic iron-sulfur protein assembly 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025296.2-1581s1c1
Sequence:CCGGCGGGCTATACTTTGCTGCATACTCGAGTATGCAGCAAAGTATAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025296.2-787s1c1
Sequence:CCGGCGCCAGTATCTACCGGGCAATCTCGAGATTGCCCGGTAGATACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025296.2-643s1c1
Sequence:CCGGGTGAAGCTATACCAGGAAGAACTCGAGTTCTTCCTGGTATAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025296.2-640s1c1
Sequence:CCGGACAGTGAAGCTATACCAGGAACTCGAGTTCCTGGTATAGCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025296.2-842s1c1
Sequence:CCGGGCTGGAAATGTATCTGCACTTCTCGAGAAGTGCAGATACATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-716s21c1
Sequence:CCGGGTGAAGCTATACCAGGAAGAACTCGAGTTCTTCCTGGTATAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-915s21c1
Sequence:CCGGGCTGGAAATGTATCTGCACTTCTCGAGAAGTGCAGATACATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-638s21c1
Sequence:CCGGTCTCATACGCAGGACGTTAAGCTCGAGCTTAACGTCCTGCGTATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-1401s21c1
Sequence:CCGGTTAGGGCATGGTGTTACATTTCTCGAGAAATGTAACACCATGCCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-437s21c1
Sequence:CCGGTTTGATGCCACCACTTGTATTCTCGAGAATACAAGTGGTGGCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025296
VALIDATED
CIAO1 MISSION shRNA shRNA Plasmid DNA
cytosolic iron-sulfur protein assembly 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025296.2-1581s1c1
Sequence:CCGGCGGGCTATACTTTGCTGCATACTCGAGTATGCAGCAAAGTATAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025296.2-787s1c1
Sequence:CCGGCGCCAGTATCTACCGGGCAATCTCGAGATTGCCCGGTAGATACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025296.2-643s1c1
Sequence:CCGGGTGAAGCTATACCAGGAAGAACTCGAGTTCTTCCTGGTATAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025296.2-640s1c1
Sequence:CCGGACAGTGAAGCTATACCAGGAACTCGAGTTCCTGGTATAGCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025296.2-842s1c1
Sequence:CCGGGCTGGAAATGTATCTGCACTTCTCGAGAAGTGCAGATACATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-716s21c1
Sequence:CCGGGTGAAGCTATACCAGGAAGAACTCGAGTTCTTCCTGGTATAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-915s21c1
Sequence:CCGGGCTGGAAATGTATCTGCACTTCTCGAGAAGTGCAGATACATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-638s21c1
Sequence:CCGGTCTCATACGCAGGACGTTAAGCTCGAGCTTAACGTCCTGCGTATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-1401s21c1
Sequence:CCGGTTAGGGCATGGTGTTACATTTCTCGAGAAATGTAACACCATGCCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-437s21c1
Sequence:CCGGTTTGATGCCACCACTTGTATTCTCGAGAATACAAGTGGTGGCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025296
VALIDATED
CIAO1 MISSION shRNA Lentiviral Transduction Particles
cytosolic iron-sulfur protein assembly 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086228    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025296.2-1581s1c1
Sequence:CCGGCGGGCTATACTTTGCTGCATACTCGAGTATGCAGCAAAGTATAGCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025296.2-787s1c1
Sequence:CCGGCGCCAGTATCTACCGGGCAATCTCGAGATTGCCCGGTAGATACTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025296.2-643s1c1
Sequence:CCGGGTGAAGCTATACCAGGAAGAACTCGAGTTCTTCCTGGTATAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025296.2-640s1c1
Sequence:CCGGACAGTGAAGCTATACCAGGAACTCGAGTTCCTGGTATAGCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025296.2-842s1c1
Sequence:CCGGGCTGGAAATGTATCTGCACTTCTCGAGAAGTGCAGATACATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-716s21c1
Sequence:CCGGGTGAAGCTATACCAGGAAGAACTCGAGTTCTTCCTGGTATAGCTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-915s21c1
Sequence:CCGGGCTGGAAATGTATCTGCACTTCTCGAGAAGTGCAGATACATTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-638s21c1
Sequence:CCGGTCTCATACGCAGGACGTTAAGCTCGAGCTTAACGTCCTGCGTATGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304535    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-1401s21c1
Sequence:CCGGTTAGGGCATGGTGTTACATTTCTCGAGAAATGTAACACCATGCCCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025296.4-437s21c1
Sequence:CCGGTTTGATGCCACCACTTGTATTCTCGAGAATACAAGTGGTGGCATCAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004804
CIAO1 MISSION shRNA Bacterial Glycerol Stock
cytosolic iron-sulfur protein assembly 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-834s1c1
Sequence:CCGGCGTCTTGTAGTGATGACCGTACTCGAGTACGGTCATCACTACAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-869s1c1
Sequence:CCGGCGTCAGTATCTACCAGGCAATCTCGAGATTGCCTGGTAGATACTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-921s1c1
Sequence:CCGGCCAGTTGGAAATGTATCTGTACTCGAGTACAGATACATTTCCAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-573s1c1
Sequence:CCGGGCAGCCGAGATAAGAGCGTTTCTCGAGAAACGCTCTTATCTCGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-1092s1c1
Sequence:CCGGCCCACTTGCATCAGGCCCATTCTCGAGAATGGGCCTGATGCAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004804.2-1307s21c1
Sequence:CCGGAGCATCCTTGACCTTCATTTACTCGAGTAAATGAAGGTCAAGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-1187s21c1
Sequence:CCGGGTGGCCTTCTGGAAGTATCAGCTCGAGCTGATACTTCCAGAAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-471s21c1
Sequence:CCGGAGAAGAACCAGGATGACTTTGCTCGAGCAAAGTCATCCTGGTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-1023s21c1
Sequence:CCGGATGACGCGATCCGCGTGTTTCCTCGAGGAAACACGCGGATCGCGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-620s21c1
Sequence:CCGGGAGTATGAATGTGTCAGTGTTCTCGAGAACACTGACACATTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004804
CIAO1 MISSION shRNA shRNA Plasmid DNA
cytosolic iron-sulfur protein assembly 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-834s1c1
Sequence:CCGGCGTCTTGTAGTGATGACCGTACTCGAGTACGGTCATCACTACAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-869s1c1
Sequence:CCGGCGTCAGTATCTACCAGGCAATCTCGAGATTGCCTGGTAGATACTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-921s1c1
Sequence:CCGGCCAGTTGGAAATGTATCTGTACTCGAGTACAGATACATTTCCAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-573s1c1
Sequence:CCGGGCAGCCGAGATAAGAGCGTTTCTCGAGAAACGCTCTTATCTCGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-1092s1c1
Sequence:CCGGCCCACTTGCATCAGGCCCATTCTCGAGAATGGGCCTGATGCAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004804.2-1307s21c1
Sequence:CCGGAGCATCCTTGACCTTCATTTACTCGAGTAAATGAAGGTCAAGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-1187s21c1
Sequence:CCGGGTGGCCTTCTGGAAGTATCAGCTCGAGCTGATACTTCCAGAAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-471s21c1
Sequence:CCGGAGAAGAACCAGGATGACTTTGCTCGAGCAAAGTCATCCTGGTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-1023s21c1
Sequence:CCGGATGACGCGATCCGCGTGTTTCCTCGAGGAAACACGCGGATCGCGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-620s21c1
Sequence:CCGGGAGTATGAATGTGTCAGTGTTCTCGAGAACACTGACACATTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004804
CIAO1 MISSION shRNA Lentiviral Transduction Particles
cytosolic iron-sulfur protein assembly 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-834s1c1
Sequence:CCGGCGTCTTGTAGTGATGACCGTACTCGAGTACGGTCATCACTACAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-869s1c1
Sequence:CCGGCGTCAGTATCTACCAGGCAATCTCGAGATTGCCTGGTAGATACTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-921s1c1
Sequence:CCGGCCAGTTGGAAATGTATCTGTACTCGAGTACAGATACATTTCCAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-573s1c1
Sequence:CCGGGCAGCCGAGATAAGAGCGTTTCTCGAGAAACGCTCTTATCTCGGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004804.2-1092s1c1
Sequence:CCGGCCCACTTGCATCAGGCCCATTCTCGAGAATGGGCCTGATGCAAGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436443    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004804.2-1307s21c1
Sequence:CCGGAGCATCCTTGACCTTCATTTACTCGAGTAAATGAAGGTCAAGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-1187s21c1
Sequence:CCGGGTGGCCTTCTGGAAGTATCAGCTCGAGCTGATACTTCCAGAAGGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-471s21c1
Sequence:CCGGAGAAGAACCAGGATGACTTTGCTCGAGCAAAGTCATCCTGGTTCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-1023s21c1
Sequence:CCGGATGACGCGATCCGCGTGTTTCCTCGAGGAAACACGCGGATCGCGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417868    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004804.2-620s21c1
Sequence:CCGGGAGTATGAATGTGTCAGTGTTCTCGAGAACACTGACACATTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks