EMAIL THIS PAGE TO A FRIEND

CIAPIN1

cytokine induced apoptosis inhibitor 1

52 Gene Product Result for
Synonyms: 2810413N20Rik Anamorsin DRE2 PRO0915
UniProtKB ID: Q6FI81, A8K8B6, O75206, O75207, Q9H0W1, Q9P1L7
Gene ID:
Human(57019) Summary: CIAPIN1 is a cytokine-induced inhibitor of apoptosis with no relation to apoptosis regulatory molecules of the BCL2 (MIM 151430) or CASP (see MIM 147678) families. Expression of CIAPIN1 is dependent on growth factor stimulation (Shibayama et al., 2004 [PubMed 14970183]
Mouse(109006) cytokine induced apoptosis inhibitor 1
Rat(307649) cytokine induced apoptosis inhibitor 1
Zebrafish(445283) cytokine induced apoptosis inhibitor 1
dog(478111) cytokine induced apoptosis inhibitor 1
chicken(415637) cytokine induced apoptosis inhibitor 1
domestic cat(101085257) cytokine induced apoptosis inhibitor 1
cow(535119) cytokine induced apoptosis inhibitor 1
sheep(101123398) cytokine induced apoptosis inhibitor 1
domestic guinea pig(100723653) cytokine induced apoptosis inhibitor 1
naked mole-rat(101696835) cytokine induced apoptosis inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020313 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134141 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134141 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134141 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020313 Rosetta Predictions human pricing
NM_001007689 Rosetta Predictions rat pricing
NM_134141 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215998 predicted 255
2 SASI_Hs01_00216003 predicted 259
3 SASI_Hs02_00353228 predicted 1082
4 SASI_Hs02_00353229 predicted 513
5 SASI_Hs02_00353230 predicted 614
6 SASI_Hs01_00215999 predicted 679
7 SASI_Hs01_00216001 predicted 960
8 SASI_Hs01_00216002 predicted 581
9 SASI_Hs01_00216004 predicted 629
10 SASI_Hs01_00216005 predicted 458
11 SASI_Hs01_00215997 predicted 471
12 SASI_Hs01_00216000 predicted 527
13 SASI_Hs01_00216006 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007689 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064654 predicted 480
2 SASI_Rn01_00064655 predicted 1452
3 SASI_Rn01_00064656 predicted 488
4 SASI_Rn01_00064657 predicted 600
5 SASI_Rn01_00064658 predicted 1478
6 SASI_Rn01_00064659 predicted 361
7 SASI_Rn01_00064660 predicted 1516
8 SASI_Rn01_00064661 predicted 787
9 SASI_Rn01_00064662 predicted 1465
10 SASI_Rn02_00198840 predicted 353
11 SASI_Rn01_00064653 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134141 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339401 predicted 759
2 SASI_Mm02_00339402 predicted 1328
3 SASI_Mm02_00339403 predicted 415
4 SASI_Mm02_00339404 predicted 1322
5 SASI_Mm02_00339405 predicted 410
6 SASI_Mm02_00339406 predicted 757
7 SASI_Mm02_00339407 predicted 708
8 SASI_Mm02_00339408 predicted 605
9 SASI_Mm02_00339409 predicted 517
10 SASI_Mm02_00339410 predicted 410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020313
VALIDATED
CIAPIN1 MISSION shRNA Bacterial Glycerol Stock
cytokine induced apoptosis inhibitor 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000343365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020313.2-1662s21c1
Sequence:CCGGGCATTGCATCTGTGTCCTGTTCTCGAGAACAGGACACAGATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020313.2-257s21c1
Sequence:CCGGTGGATAAGCTTCAAGCGTTAACTCGAGTTAACGCTTGAAGCTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020313.2-465s21c1
Sequence:CCGGAGTAGAGACAGCTGTAGATAACTCGAGTTATCTACAGCTGTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020313.2-340s21c1
Sequence:CCGGGAATCCAGCTTTGACATTATTCTCGAGAATAATGTCAAAGCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020313.2-766s21c1
Sequence:CCGGACCCTCTCAGCCAACGATATGCTCGAGCATATCGTTGGCTGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168568    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020313.1-1922s1c1
Sequence:CCGGGCAGAACTCTGAACGACAATACTCGAGTATTGTCGTTCAGAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020313.1-1512s1c1
Sequence:CCGGGAGTTGTTAGTTTACTCCATTCTCGAGAATGGAGTAAACTAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020313.1-703s1c1
Sequence:CCGGGACTCCAAGTTTCCTCTCGAACTCGAGTTCGAGAGGAAACTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020313.1-594s1c1
Sequence:CCGGCATCTTCTGTGGATGTAGTTTCTCGAGAAACTACATCCACAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020313.1-452s1c1
Sequence:CCGGCAAACTTTGAAGTGGGTTCTTCTCGAGAAGAACCCACTTCAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020313.1-1656s1c1
Sequence:CCGGGCATTGCATCTGTGTCCTGTTCTCGAGAACAGGACACAGATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020313
VALIDATED
CIAPIN1 MISSION shRNA shRNA Plasmid DNA
cytokine induced apoptosis inhibitor 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000343365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020313.2-1662s21c1
Sequence:CCGGGCATTGCATCTGTGTCCTGTTCTCGAGAACAGGACACAGATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020313.2-257s21c1
Sequence:CCGGTGGATAAGCTTCAAGCGTTAACTCGAGTTAACGCTTGAAGCTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020313.2-465s21c1
Sequence:CCGGAGTAGAGACAGCTGTAGATAACTCGAGTTATCTACAGCTGTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020313.2-340s21c1
Sequence:CCGGGAATCCAGCTTTGACATTATTCTCGAGAATAATGTCAAAGCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020313.2-766s21c1
Sequence:CCGGACCCTCTCAGCCAACGATATGCTCGAGCATATCGTTGGCTGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168568    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020313.1-1922s1c1
Sequence:CCGGGCAGAACTCTGAACGACAATACTCGAGTATTGTCGTTCAGAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020313.1-1512s1c1
Sequence:CCGGGAGTTGTTAGTTTACTCCATTCTCGAGAATGGAGTAAACTAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020313.1-703s1c1
Sequence:CCGGGACTCCAAGTTTCCTCTCGAACTCGAGTTCGAGAGGAAACTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020313.1-594s1c1
Sequence:CCGGCATCTTCTGTGGATGTAGTTTCTCGAGAAACTACATCCACAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020313.1-452s1c1
Sequence:CCGGCAAACTTTGAAGTGGGTTCTTCTCGAGAAGAACCCACTTCAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020313.1-1656s1c1
Sequence:CCGGGCATTGCATCTGTGTCCTGTTCTCGAGAACAGGACACAGATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020313
VALIDATED
CIAPIN1 MISSION shRNA Lentiviral Transduction Particles
cytokine induced apoptosis inhibitor 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000343365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020313.2-1662s21c1
Sequence:CCGGGCATTGCATCTGTGTCCTGTTCTCGAGAACAGGACACAGATGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020313.2-257s21c1
Sequence:CCGGTGGATAAGCTTCAAGCGTTAACTCGAGTTAACGCTTGAAGCTTATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020313.2-465s21c1
Sequence:CCGGAGTAGAGACAGCTGTAGATAACTCGAGTTATCTACAGCTGTCTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_020313.2-340s21c1
Sequence:CCGGGAATCCAGCTTTGACATTATTCTCGAGAATAATGTCAAAGCTGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020313.2-766s21c1
Sequence:CCGGACCCTCTCAGCCAACGATATGCTCGAGCATATCGTTGGCTGAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168568    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020313.1-1922s1c1
Sequence:CCGGGCAGAACTCTGAACGACAATACTCGAGTATTGTCGTTCAGAGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020313.1-1512s1c1
Sequence:CCGGGAGTTGTTAGTTTACTCCATTCTCGAGAATGGAGTAAACTAACAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020313.1-703s1c1
Sequence:CCGGGACTCCAAGTTTCCTCTCGAACTCGAGTTCGAGAGGAAACTTGGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133842    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020313.1-594s1c1
Sequence:CCGGCATCTTCTGTGGATGTAGTTTCTCGAGAAACTACATCCACAGAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020313.1-452s1c1
Sequence:CCGGCAAACTTTGAAGTGGGTTCTTCTCGAGAAGAACCCACTTCAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136738    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_020313.1-1656s1c1
Sequence:CCGGGCATTGCATCTGTGTCCTGTTCTCGAGAACAGGACACAGATGCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134141
VALIDATED
CIAPIN1 MISSION shRNA Bacterial Glycerol Stock
cytokine induced apoptosis inhibitor 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000200708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134141.2-384s1c1
Sequence:CCGGGCTGAAGTTAACAATGACAAACTCGAGTTTGTCATTGTTAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134141.2-725s1c1
Sequence:CCGGGCTGCTTGATCCAGAGGATTTCTCGAGAAATCCTCTGGATCAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134141.2-1290s1c1
Sequence:CCGGCTTGAGTATTTATGCTGAGTACTCGAGTACTCAGCATAAATACTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134141.2-129s1c1
Sequence:CCGGGACAAGTCATCTCCTGAGGAACTCGAGTTCCTCAGGAGATGACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134141
VALIDATED
CIAPIN1 MISSION shRNA shRNA Plasmid DNA
cytokine induced apoptosis inhibitor 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000200708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134141.2-384s1c1
Sequence:CCGGGCTGAAGTTAACAATGACAAACTCGAGTTTGTCATTGTTAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134141.2-725s1c1
Sequence:CCGGGCTGCTTGATCCAGAGGATTTCTCGAGAAATCCTCTGGATCAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134141.2-1290s1c1
Sequence:CCGGCTTGAGTATTTATGCTGAGTACTCGAGTACTCAGCATAAATACTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134141.2-129s1c1
Sequence:CCGGGACAAGTCATCTCCTGAGGAACTCGAGTTCCTCAGGAGATGACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134141
VALIDATED
CIAPIN1 MISSION shRNA Lentiviral Transduction Particles
cytokine induced apoptosis inhibitor 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000200708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_134141.2-384s1c1
Sequence:CCGGGCTGAAGTTAACAATGACAAACTCGAGTTTGTCATTGTTAACTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134141.2-725s1c1
Sequence:CCGGGCTGCTTGATCCAGAGGATTTCTCGAGAAATCCTCTGGATCAAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134141.2-1290s1c1
Sequence:CCGGCTTGAGTATTTATGCTGAGTACTCGAGTACTCAGCATAAATACTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134141.2-129s1c1
Sequence:CCGGGACAAGTCATCTCCTGAGGAACTCGAGTTCCTCAGGAGATGACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks