EMAIL THIS PAGE TO A FRIEND

CIB1

calcium and integrin binding 1 (calmyrin)

64 Gene Product Result for
Synonyms: CIB CIBP KIP1 PRKDCIP SIP2-28
Gene ID:
Human(10519) Summary: This gene encodes a member of the EF-hand domain-containing calcium-binding superfamily. The encoded protein interacts with many other proteins, including the platelet integrin alpha-IIb-beta-3, DNA-dependent protein kinase, presenilin-2, focal adhesion kinase, p21 activated kinase, and protein kinase D. The encoded protein may be involved in cell survival and proliferation, and is associated with several disease states including cancer and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2013]
Mouse(23991) calcium and integrin binding 1 (calmyrin)
Rat(81823) calcium and integrin binding 1 (calmyrin)
Zebrafish(550376) calcium and integrin binding 1 (calmyrin)
Thale Cress(829604) cryptochrome-interacting basic-helix-loop-helix 1
cow(510141) calcium and integrin binding 1 (calmyrin)
domestic cat(101088843) calcium and integrin binding 1 (calmyrin)
dog(479044) calcium and integrin binding 1 (calmyrin)
chicken(770162) calcium and integrin binding 1 (calmyrin)
naked mole-rat(101711426) calcium and integrin binding 1 (calmyrin)
domestic guinea pig(100726412) calcium and integrin binding 1 (calmyrin)
sheep(100141300) calcium and integrin binding 1 (calmyrin)
Gene Class: Apoptosis
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA048825 Anti-CIB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB4301197 Anti-CIB1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006384 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006384 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006384 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU019951 MISSION® esiRNA esiRNA targeting mouse Cib1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006384 Rosetta Predictions human pricing
NM_031145 Rosetta Predictions rat pricing
NM_011870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006384 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084549 predicted 584
2 SASI_Hs02_00341455 predicted 206
3 SASI_Hs01_00084550 predicted 698
4 SASI_Hs01_00084551 predicted 483
5 SASI_Hs01_00084553 predicted 364
6 SASI_Hs01_00084554 predicted 468
7 SASI_Hs02_00341456 predicted 238
8 SASI_Hs01_00084555 predicted 655
9 SASI_Hs01_00084556 predicted 540
10 SASI_Hs01_00084557 predicted 453
11 SASI_Hs01_00084552 predicted 319
12 SASI_Hs01_00084558 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031145 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068121 predicted 579
2 SASI_Rn01_00068122 predicted 368
3 SASI_Rn01_00068123 predicted 362
4 SASI_Rn01_00068124 predicted 375
5 SASI_Rn01_00068125 predicted 250
6 SASI_Rn01_00068127 predicted 341
7 SASI_Rn01_00068128 predicted 467
8 SASI_Rn01_00068129 predicted 532
9 SASI_Rn01_00068130 predicted 416
10 SASI_Rn02_00264484 predicted 522
11 SASI_Rn01_00068126 predicted 526
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161850 predicted 388
2 SASI_Mm01_00161853 predicted 297
3 SASI_Mm01_00161854 predicted 239
4 SASI_Mm01_00161855 predicted 203
5 SASI_Mm01_00161856 predicted 360
6 SASI_Mm01_00161857 predicted 294
7 SASI_Mm01_00161858 predicted 541
8 SASI_Mm01_00161859 predicted 527
9 SASI_Mm02_00321653 predicted 443
10 SASI_Mm02_00321654 predicted 554
11 SASI_Mm01_00161851 predicted 376
12 SASI_Mm01_00161852 predicted 387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011870
VALIDATED
CIB1 MISSION shRNA Bacterial Glycerol Stock
calcium and integrin binding 1 (calmyrin)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120582    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011870.2-675s1c1
Sequence:CCGGGCTGAGATGTGGCCAAGGTTACTCGAGTAACCTTGGCCACATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011870.2-210s1c1
Sequence:CCGGCCGAGTATCGTTTGAGCAGATCTCGAGATCTGCTCAAACGATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011870.2-246s1c1
Sequence:CCGGGCTCAAGGCTAACCCTTTCAACTCGAGTTGAAAGGGTTAGCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011870.2-603s1c1
Sequence:CCGGCTTTGCCAGCTCCTTTAAGATCTCGAGATCTTAAAGGAGCTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011870.2-367s1c1
Sequence:CCGGCCAGACATCAAGTCACACTATCTCGAGATAGTGTGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011870.4-642s21c1
Sequence:CCGGAGTACCAACATCCTGTCCAAGCTCGAGCTTGGACAGGATGTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-503s21c1
Sequence:CCGGGAAGCAGCTGATTGACAATATCTCGAGATATTGTCAATCAGCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-366s21c1
Sequence:CCGGCCAGACATCAAGTCACACTATCTCGAGATAGTGTGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-548s21c1
Sequence:CCGGGGATGGGACCATCAATCTTTCCTCGAGGAAAGATTGATGGTCCCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-602s21c1
Sequence:CCGGCTTTGCCAGCTCCTTTAAGATCTCGAGATCTTAAAGGAGCTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011870
VALIDATED
CIB1 MISSION shRNA shRNA Plasmid DNA
calcium and integrin binding 1 (calmyrin)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120582    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011870.2-675s1c1
Sequence:CCGGGCTGAGATGTGGCCAAGGTTACTCGAGTAACCTTGGCCACATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011870.2-210s1c1
Sequence:CCGGCCGAGTATCGTTTGAGCAGATCTCGAGATCTGCTCAAACGATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011870.2-246s1c1
Sequence:CCGGGCTCAAGGCTAACCCTTTCAACTCGAGTTGAAAGGGTTAGCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011870.2-603s1c1
Sequence:CCGGCTTTGCCAGCTCCTTTAAGATCTCGAGATCTTAAAGGAGCTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011870.2-367s1c1
Sequence:CCGGCCAGACATCAAGTCACACTATCTCGAGATAGTGTGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011870.4-642s21c1
Sequence:CCGGAGTACCAACATCCTGTCCAAGCTCGAGCTTGGACAGGATGTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-503s21c1
Sequence:CCGGGAAGCAGCTGATTGACAATATCTCGAGATATTGTCAATCAGCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-366s21c1
Sequence:CCGGCCAGACATCAAGTCACACTATCTCGAGATAGTGTGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-548s21c1
Sequence:CCGGGGATGGGACCATCAATCTTTCCTCGAGGAAAGATTGATGGTCCCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-602s21c1
Sequence:CCGGCTTTGCCAGCTCCTTTAAGATCTCGAGATCTTAAAGGAGCTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011870
VALIDATED
CIB1 MISSION shRNA Lentiviral Transduction Particles
calcium and integrin binding 1 (calmyrin)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120582    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011870.2-675s1c1
Sequence:CCGGGCTGAGATGTGGCCAAGGTTACTCGAGTAACCTTGGCCACATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011870.2-210s1c1
Sequence:CCGGCCGAGTATCGTTTGAGCAGATCTCGAGATCTGCTCAAACGATACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120585    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011870.2-246s1c1
Sequence:CCGGGCTCAAGGCTAACCCTTTCAACTCGAGTTGAAAGGGTTAGCCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011870.2-603s1c1
Sequence:CCGGCTTTGCCAGCTCCTTTAAGATCTCGAGATCTTAAAGGAGCTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011870.2-367s1c1
Sequence:CCGGCCAGACATCAAGTCACACTATCTCGAGATAGTGTGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011870.4-642s21c1
Sequence:CCGGAGTACCAACATCCTGTCCAAGCTCGAGCTTGGACAGGATGTTGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-503s21c1
Sequence:CCGGGAAGCAGCTGATTGACAATATCTCGAGATATTGTCAATCAGCTGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-366s21c1
Sequence:CCGGCCAGACATCAAGTCACACTATCTCGAGATAGTGTGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328456    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-548s21c1
Sequence:CCGGGGATGGGACCATCAATCTTTCCTCGAGGAAAGATTGATGGTCCCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011870.4-602s21c1
Sequence:CCGGCTTTGCCAGCTCCTTTAAGATCTCGAGATCTTAAAGGAGCTGGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006384
VALIDATED
CIB1 MISSION shRNA Bacterial Glycerol Stock
calcium and integrin binding 1 (calmyrin)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000053588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-376s1c1
Sequence:CCGGCCAGACATCAAGTCCCATTATCTCGAGATAATGGGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-318s1c1
Sequence:CCGGCAGCCTTAGCTTTGAGGACTTCTCGAGAAGTCCTCAAAGCTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-607s1c1
Sequence:CCGGCCAGACTTTGCCAGCTCCTTTCTCGAGAAAGGAGCTGGCAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-504s1c1
Sequence:CCGGGTCTGAGATGAAGCAGCTCATCTCGAGATGAGCTGCTTCATCTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000053589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-397s1c1
Sequence:CCGGGCCTTCCGCATCTTTGACTTTCTCGAGAAAGTCAAAGATGCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-515s21c1
Sequence:GTACCGGATGATGACGGAACCTTGAACACTCGAGTGTTCAAGGTTCCGTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-673s21c1
Sequence:GTACCGGTCTGAGTTCCAGCACGTCATCCTCGAGGATGACGTGCTGGAACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006384.3-600s21c1
Sequence:CCGGGTCTGAGATGAAGCAGCTCATCTCGAGATGAGCTGCTTCATCTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-472s21c1
Sequence:CCGGCCAGACATCAAGTCCCATTATCTCGAGATAATGGGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006384.3-414s21c1
Sequence:CCGGCAGCCTTAGCTTTGAGGACTTCTCGAGAAGTCCTCAAAGCTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-706s21c1
Sequence:GTACCGGGACTTTGCCAGCTCCTTTAAGCTCGAGCTTAAAGGAGCTGGCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-493s21c1
Sequence:CCGGGCCTTCCGCATCTTTGACTTTCTCGAGAAAGTCAAAGATGCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006384
VALIDATED
CIB1 MISSION shRNA shRNA Plasmid DNA
calcium and integrin binding 1 (calmyrin)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000053588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-376s1c1
Sequence:CCGGCCAGACATCAAGTCCCATTATCTCGAGATAATGGGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-318s1c1
Sequence:CCGGCAGCCTTAGCTTTGAGGACTTCTCGAGAAGTCCTCAAAGCTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-607s1c1
Sequence:CCGGCCAGACTTTGCCAGCTCCTTTCTCGAGAAAGGAGCTGGCAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-504s1c1
Sequence:CCGGGTCTGAGATGAAGCAGCTCATCTCGAGATGAGCTGCTTCATCTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000053589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-397s1c1
Sequence:CCGGGCCTTCCGCATCTTTGACTTTCTCGAGAAAGTCAAAGATGCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-515s21c1
Sequence:GTACCGGATGATGACGGAACCTTGAACACTCGAGTGTTCAAGGTTCCGTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-673s21c1
Sequence:GTACCGGTCTGAGTTCCAGCACGTCATCCTCGAGGATGACGTGCTGGAACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006384.3-600s21c1
Sequence:CCGGGTCTGAGATGAAGCAGCTCATCTCGAGATGAGCTGCTTCATCTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-472s21c1
Sequence:CCGGCCAGACATCAAGTCCCATTATCTCGAGATAATGGGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006384.3-414s21c1
Sequence:CCGGCAGCCTTAGCTTTGAGGACTTCTCGAGAAGTCCTCAAAGCTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-706s21c1
Sequence:GTACCGGGACTTTGCCAGCTCCTTTAAGCTCGAGCTTAAAGGAGCTGGCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-493s21c1
Sequence:CCGGGCCTTCCGCATCTTTGACTTTCTCGAGAAAGTCAAAGATGCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006384
VALIDATED
CIB1 MISSION shRNA Lentiviral Transduction Particles
calcium and integrin binding 1 (calmyrin)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000053588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-376s1c1
Sequence:CCGGCCAGACATCAAGTCCCATTATCTCGAGATAATGGGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-318s1c1
Sequence:CCGGCAGCCTTAGCTTTGAGGACTTCTCGAGAAGTCCTCAAAGCTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-607s1c1
Sequence:CCGGCCAGACTTTGCCAGCTCCTTTCTCGAGAAAGGAGCTGGCAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-504s1c1
Sequence:CCGGGTCTGAGATGAAGCAGCTCATCTCGAGATGAGCTGCTTCATCTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000053589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006384.2-397s1c1
Sequence:CCGGGCCTTCCGCATCTTTGACTTTCTCGAGAAAGTCAAAGATGCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-515s21c1
Sequence:GTACCGGATGATGACGGAACCTTGAACACTCGAGTGTTCAAGGTTCCGTCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-673s21c1
Sequence:GTACCGGTCTGAGTTCCAGCACGTCATCCTCGAGGATGACGTGCTGGAACTCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006384.3-600s21c1
Sequence:CCGGGTCTGAGATGAAGCAGCTCATCTCGAGATGAGCTGCTTCATCTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-472s21c1
Sequence:CCGGCCAGACATCAAGTCCCATTATCTCGAGATAATGGGACTTGATGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006384.3-414s21c1
Sequence:CCGGCAGCCTTAGCTTTGAGGACTTCTCGAGAAGTCCTCAAAGCTAAGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-706s21c1
Sequence:GTACCGGGACTTTGCCAGCTCCTTTAAGCTCGAGCTTAAAGGAGCTGGCAAAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006384.3-493s21c1
Sequence:CCGGGCCTTCCGCATCTTTGACTTTCTCGAGAAAGTCAAAGATGCGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks