EMAIL THIS PAGE TO A FRIEND

CIB2

calcium and integrin binding family member 2

64 Gene Product Result for
Synonyms: DFNB48 KIP2 USH1J
UniProtKB ID: O75838
Gene ID:
Human(10518) Summary: The protein encoded by this gene is similar to that of KIP/CIB, calcineurin B, and calmodulin. This suggests that the encoded protein may be a calcium-binding regulatory protein that interacts with DNA-dependent protein kinase catalytic subunits (DNA-PKcs). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(56506) calcium and integrin binding family member 2
Rat(300719) calcium and integrin binding family member 2
sheep(100302744) calcium and integrin binding family member 2
domestic guinea pig(100719842) calcium and integrin binding family member 2
naked mole-rat(101707233) calcium and integrin binding family member 2
Zebrafish(393679) calcium and integrin binding family member 2
cow(100337259) calcium and integrin binding family member 2-like
domestic cat(101085978) calcium and integrin binding family member 2
dog(491539) calcium and integrin binding family member 2
chicken(415363) calcium and integrin binding family member 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019686 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019686 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019686 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006383 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006383 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006383 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006383 Rosetta Predictions human pricing
NM_001015010 Rosetta Predictions rat pricing
NM_019686 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006383 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122568 predicted 642
2 SASI_Hs01_00122569 predicted 676
3 SASI_Hs01_00122570 predicted 582
4 SASI_Hs02_00341454 predicted 749
5 SASI_Hs01_00122571 predicted 637
6 SASI_Hs01_00122572 predicted 634
7 SASI_Hs01_00122573 predicted 764
8 SASI_Hs01_00122574 predicted 644
9 SASI_Hs01_00122575 predicted 643
10 SASI_Hs01_00122576 predicted 789
11 SASI_Hs01_00122577 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201971 predicted 454
2 SASI_Rn02_00201972 predicted 288
3 SASI_Rn02_00201973 predicted 223
4 SASI_Rn02_00201974 predicted 496
5 SASI_Rn02_00201975 predicted 506
6 SASI_Rn02_00201976 predicted 525
7 SASI_Rn02_00201977 predicted 592
8 SASI_Rn02_00201978 predicted 340
9 SASI_Rn02_00201979 predicted 390
10 SASI_Rn02_00201980 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019686 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324766 predicted 492
2 SASI_Mm02_00324767 predicted 319
3 SASI_Mm01_00127753 predicted 407
4 SASI_Mm01_00127754 predicted 192
5 SASI_Mm01_00127755 predicted 337
6 SASI_Mm01_00127756 predicted 221
7 SASI_Mm01_00127757 predicted 257
8 SASI_Mm01_00127758 predicted 403
9 SASI_Mm02_00324768 predicted 208
10 SASI_Mm02_00324769 predicted 512
11 SASI_Mm01_00127752 predicted 279
12 SASI_Mm01_00127759 predicted 238
13 SASI_Mm01_00127760 predicted 289
14 SASI_Mm01_00127761 predicted 531
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019686
VALIDATED
CIB2 MISSION shRNA Bacterial Glycerol Stock
calcium and integrin binding family member 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-147s21c1
Sequence:CCGGAGCTTCATGCACGGTTCTATGCTCGAGCATAGAACCGTGCATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-565s21c1
Sequence:CCGGCTTTGAGGACATGATCGCCAACTCGAGTTGGCGATCATGTCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-262s21c1
Sequence:CCGGGAATCCCTTCAAAGAGAGGATCTCGAGATCCTCTCTTTGAAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-430s21c1
Sequence:CCGGCTGTAAAGAAGACTTAGAGATCTCGAGATCTCTAAGTCTTCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019686.3-1239s1c1
Sequence:CCGGCCCGTACTTTCCCAATGTGAACTCGAGTTCACATTGGGAAAGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019686.3-371s1c1
Sequence:CCGGGAATCCCTTCAAAGAGAGGATCTCGAGATCCTCTCTTTGAAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019686.3-674s1c1
Sequence:CCGGCTTTGAGGACATGATCGCCAACTCGAGTTGGCGATCATGTCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019686.3-539s1c1
Sequence:CCGGCTGTAAAGAAGACTTAGAGATCTCGAGATCTCTAAGTCTTCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000104786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019686.3-488s1c1
Sequence:CCGGCAAGGCAAACTATGCCTTCAACTCGAGTTGAAGGCATAGTTTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019686
VALIDATED
CIB2 MISSION shRNA shRNA Plasmid DNA
calcium and integrin binding family member 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-147s21c1
Sequence:CCGGAGCTTCATGCACGGTTCTATGCTCGAGCATAGAACCGTGCATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-565s21c1
Sequence:CCGGCTTTGAGGACATGATCGCCAACTCGAGTTGGCGATCATGTCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-262s21c1
Sequence:CCGGGAATCCCTTCAAAGAGAGGATCTCGAGATCCTCTCTTTGAAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-430s21c1
Sequence:CCGGCTGTAAAGAAGACTTAGAGATCTCGAGATCTCTAAGTCTTCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019686.3-1239s1c1
Sequence:CCGGCCCGTACTTTCCCAATGTGAACTCGAGTTCACATTGGGAAAGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019686.3-371s1c1
Sequence:CCGGGAATCCCTTCAAAGAGAGGATCTCGAGATCCTCTCTTTGAAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019686.3-674s1c1
Sequence:CCGGCTTTGAGGACATGATCGCCAACTCGAGTTGGCGATCATGTCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019686.3-539s1c1
Sequence:CCGGCTGTAAAGAAGACTTAGAGATCTCGAGATCTCTAAGTCTTCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000104786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019686.3-488s1c1
Sequence:CCGGCAAGGCAAACTATGCCTTCAACTCGAGTTGAAGGCATAGTTTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019686
VALIDATED
CIB2 MISSION shRNA Lentiviral Transduction Particles
calcium and integrin binding family member 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348572    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-147s21c1
Sequence:CCGGAGCTTCATGCACGGTTCTATGCTCGAGCATAGAACCGTGCATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-565s21c1
Sequence:CCGGCTTTGAGGACATGATCGCCAACTCGAGTTGGCGATCATGTCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335618    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-262s21c1
Sequence:CCGGGAATCCCTTCAAAGAGAGGATCTCGAGATCCTCTCTTTGAAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335610    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019686.5-430s21c1
Sequence:CCGGCTGTAAAGAAGACTTAGAGATCTCGAGATCTCTAAGTCTTCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019686.3-1239s1c1
Sequence:CCGGCCCGTACTTTCCCAATGTGAACTCGAGTTCACATTGGGAAAGTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104787    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019686.3-371s1c1
Sequence:CCGGGAATCCCTTCAAAGAGAGGATCTCGAGATCCTCTCTTTGAAGGGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019686.3-674s1c1
Sequence:CCGGCTTTGAGGACATGATCGCCAACTCGAGTTGGCGATCATGTCCTCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_019686.3-539s1c1
Sequence:CCGGCTGTAAAGAAGACTTAGAGATCTCGAGATCTCTAAGTCTTCTTTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000104786    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019686.3-488s1c1
Sequence:CCGGCAAGGCAAACTATGCCTTCAACTCGAGTTGAAGGCATAGTTTGCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006383
VALIDATED
CIB2 MISSION shRNA Bacterial Glycerol Stock
calcium and integrin binding family member 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000332903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006383.2-517s21c1
Sequence:CCGGCGGGAGAATCCCTTCAAAGAACTCGAGTTCTTTGAAGGGATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006383.2-821s21c1
Sequence:CCGGCTGACTTCGAGGACATGATTGCTCGAGCAATCATGTCCTCGAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006383.2-1150s21c1
Sequence:CCGGGTCCTTTCCTACTCCAGAAATCTCGAGATTTCTGGAGTAGGAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006383.2-631s21c1
Sequence:CCGGCGAGAGCTCAAGGCAAACTATCTCGAGATAGTTTGCCTTGAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-835s1c1
Sequence:CCGGGTCCTTTCCTACTCCAGAAATCTCGAGATTTCTGGAGTAGGAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-202s1c1
Sequence:CCGGCGGGAGAATCCCTTCAAAGAACTCGAGTTCTTTGAAGGGATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-505s1c1
Sequence:CCGGGCTGACTTCGAGGACATGATTCTCGAGAATCATGTCCTCGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-316s1c1
Sequence:CCGGCGAGAGCTCAAGGCAAACTATCTCGAGATAGTTTGCCTTGAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-258s1c1
Sequence:CCGGGAACCTCACTTTCAACGACTTCTCGAGAAGTCGTTGAAAGTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006383.x-48s1c1
Sequence:CCGGCAACTACCAGGACTGCACCTTCTCGAGAAGGTGCAGTCCTGGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.x-1061s1c1
Sequence:CCGGCCTCCTTCACAATGTGAAGCTCTCGAGAGCTTCACATTGTGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006383
VALIDATED
CIB2 MISSION shRNA shRNA Plasmid DNA
calcium and integrin binding family member 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000332903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006383.2-517s21c1
Sequence:CCGGCGGGAGAATCCCTTCAAAGAACTCGAGTTCTTTGAAGGGATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006383.2-821s21c1
Sequence:CCGGCTGACTTCGAGGACATGATTGCTCGAGCAATCATGTCCTCGAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006383.2-1150s21c1
Sequence:CCGGGTCCTTTCCTACTCCAGAAATCTCGAGATTTCTGGAGTAGGAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006383.2-631s21c1
Sequence:CCGGCGAGAGCTCAAGGCAAACTATCTCGAGATAGTTTGCCTTGAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-835s1c1
Sequence:CCGGGTCCTTTCCTACTCCAGAAATCTCGAGATTTCTGGAGTAGGAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-202s1c1
Sequence:CCGGCGGGAGAATCCCTTCAAAGAACTCGAGTTCTTTGAAGGGATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-505s1c1
Sequence:CCGGGCTGACTTCGAGGACATGATTCTCGAGAATCATGTCCTCGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-316s1c1
Sequence:CCGGCGAGAGCTCAAGGCAAACTATCTCGAGATAGTTTGCCTTGAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-258s1c1
Sequence:CCGGGAACCTCACTTTCAACGACTTCTCGAGAAGTCGTTGAAAGTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006383.x-48s1c1
Sequence:CCGGCAACTACCAGGACTGCACCTTCTCGAGAAGGTGCAGTCCTGGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.x-1061s1c1
Sequence:CCGGCCTCCTTCACAATGTGAAGCTCTCGAGAGCTTCACATTGTGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006383
VALIDATED
CIB2 MISSION shRNA Lentiviral Transduction Particles
calcium and integrin binding family member 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000332903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006383.2-517s21c1
Sequence:CCGGCGGGAGAATCCCTTCAAAGAACTCGAGTTCTTTGAAGGGATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006383.2-821s21c1
Sequence:CCGGCTGACTTCGAGGACATGATTGCTCGAGCAATCATGTCCTCGAAGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332968    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006383.2-1150s21c1
Sequence:CCGGGTCCTTTCCTACTCCAGAAATCTCGAGATTTCTGGAGTAGGAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006383.2-631s21c1
Sequence:CCGGCGAGAGCTCAAGGCAAACTATCTCGAGATAGTTTGCCTTGAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-835s1c1
Sequence:CCGGGTCCTTTCCTACTCCAGAAATCTCGAGATTTCTGGAGTAGGAAAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-202s1c1
Sequence:CCGGCGGGAGAATCCCTTCAAAGAACTCGAGTTCTTTGAAGGGATTCTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-505s1c1
Sequence:CCGGGCTGACTTCGAGGACATGATTCTCGAGAATCATGTCCTCGAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-316s1c1
Sequence:CCGGCGAGAGCTCAAGGCAAACTATCTCGAGATAGTTTGCCTTGAGCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.1-258s1c1
Sequence:CCGGGAACCTCACTTTCAACGACTTCTCGAGAAGTCGTTGAAAGTGAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006383.x-48s1c1
Sequence:CCGGCAACTACCAGGACTGCACCTTCTCGAGAAGGTGCAGTCCTGGTAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006383.x-1061s1c1
Sequence:CCGGCCTCCTTCACAATGTGAAGCTCTCGAGAGCTTCACATTGTGAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks