EMAIL THIS PAGE TO A FRIEND

CIB3

calcium and integrin binding family member 3

57 Gene Product Result for
Synonyms: KIP3
UniProtKB ID: Q96Q77, Q2M1W0
Gene ID:
Human(117286) Summary: This gene product shares a high degree of sequence similarity with DNA-dependent protein kinase catalytic subunit-interacting protein 2 in human and mouse, and like them may bind the catalytic subunit of DNA-dependent protein kinases. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Mouse(234421) calcium and integrin binding family member 3
Rat(685723) calcium and integrin binding family member 3
Zebrafish(101101843) calcium and integrin binding family member 3
dog(610270) calcium and integrin binding family member 3
domestic cat(101092918) calcium and integrin binding family member 3
cow(539263) calcium and integrin binding family member 3
chicken(420151) calcium and integrin binding family member 3
naked mole-rat(101707967) calcium and integrin binding family member 3
domestic guinea pig(100733858) calcium and integrin binding family member 3
sheep(100302745) calcium and integrin binding family member 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_356089 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_356089 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_356089 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_054113 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_054113 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_054113 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001080812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001080812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001080812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_054113 Rosetta Predictions human pricing
XM_001062162 Rosetta Predictions rat pricing
XM_356089 Rosetta Predictions mouse pricing
XM_904518 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054113 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106936 predicted 37
2 SASI_Hs01_00106937 predicted 312
3 SASI_Hs01_00106938 predicted 157
4 SASI_Hs02_00361994 predicted 41
5 SASI_Hs01_00106939 predicted 211
6 SASI_Hs01_00106941 predicted 569
7 SASI_Hs02_00361995 predicted 313
8 SASI_Hs01_00106943 predicted 536
9 SASI_Hs01_00106944 predicted 215
10 SASI_Hs02_00361996 predicted 43
11 SASI_Hs01_00106940 predicted 623
12 SASI_Hs01_00106942 predicted 448
13 SASI_Hs01_00106945 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062162 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00302551 predicted 337
2 SASI_Rn02_00302552 predicted 342
3 SASI_Rn02_00302553 predicted 211
4 SASI_Rn02_00302554 predicted 282
5 SASI_Rn02_00302555 predicted 226
6 SASI_Rn02_00302556 predicted 291
7 SASI_Rn02_00302557 predicted 204
8 SASI_Rn02_00302558 predicted 244
9 SASI_Rn02_00302559 predicted 212
10 SASI_Rn02_00302560 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_356089 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00234318 predicted 276
2 SASI_Mm01_00234319 predicted 258
3 SASI_Mm01_00234321 predicted 247
4 SASI_Mm01_00234322 predicted 199
5 SASI_Mm01_00234323 predicted 250
6 SASI_Mm01_00234324 predicted 242
7 SASI_Mm01_00234325 predicted 307
8 SASI_Mm01_00234326 predicted 338
9 SASI_Mm01_00234327 predicted 213
10 SASI_Mm02_00425900 predicted 243
11 SASI_Mm01_00234320 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_904518 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00430953 predicted 267
2 SASI_Mm02_00430954 predicted 265
3 SASI_Mm02_00430955 predicted 248
4 SASI_Mm02_00430956 predicted 196
5 SASI_Mm02_00430957 predicted 251
6 SASI_Mm02_00430958 predicted 246
7 SASI_Mm02_00430959 predicted 309
8 SASI_Mm02_00430960 predicted 342
9 SASI_Mm02_00430961 predicted 210
10 SASI_Mm02_00430962 predicted 240
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_356089
CIB3 MISSION shRNA Bacterial Glycerol Stock
calcium and integrin binding family member 3
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000189044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_356089.1-350s1c1
Sequence:CCGGGAAGGCCTACTATGCCTTCAACTCGAGTTGAAGGCATAGTAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_356089.1-292s1c1
Sequence:CCGGCCTTAGAGAATTTCTTGGATACTCGAGTATCCAAGAAATTCTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_356089.1-297s1c1
Sequence:CCGGGAGAATTTCTTGGATATGTTCCTCGAGGAACATATCCAAGAAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_356089
CIB3 MISSION shRNA shRNA Plasmid DNA
calcium and integrin binding family member 3
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000189044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_356089.1-350s1c1
Sequence:CCGGGAAGGCCTACTATGCCTTCAACTCGAGTTGAAGGCATAGTAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_356089.1-292s1c1
Sequence:CCGGCCTTAGAGAATTTCTTGGATACTCGAGTATCCAAGAAATTCTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_356089.1-297s1c1
Sequence:CCGGGAGAATTTCTTGGATATGTTCCTCGAGGAACATATCCAAGAAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_356089
CIB3 MISSION shRNA Lentiviral Transduction Particles
calcium and integrin binding family member 3
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000189044    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_356089.1-350s1c1
Sequence:CCGGGAAGGCCTACTATGCCTTCAACTCGAGTTGAAGGCATAGTAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186053    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_356089.1-292s1c1
Sequence:CCGGCCTTAGAGAATTTCTTGGATACTCGAGTATCCAAGAAATTCTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185367    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_356089.1-297s1c1
Sequence:CCGGGAGAATTTCTTGGATATGTTCCTCGAGGAACATATCCAAGAAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054113
CIB3 MISSION shRNA Bacterial Glycerol Stock
calcium and integrin binding family member 3
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-43s1c1
Sequence:CCGGGCGTATCAGGACTGCACATTTCTCGAGAAATGTGCAGTCCTGATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-442s1c1
Sequence:CCGGGTATGTGAGAAGGTGCTGGATCTCGAGATCCAGCACCTTCTCACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-212s1c1
Sequence:CCGGGCCAGAGGATTGCCCAGGTATCTCGAGATACCTGGGCAATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-315s1c1
Sequence:CCGGCCTCAAGGCTTACTATGCTTTCTCGAGAAAGCATAGTAAGCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-494s1c1
Sequence:CCGGCCCTGGAAGATTTCCAGAACACTCGAGTGTTCTGGAAATCTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-489s21c1
Sequence:CCGGGCTGTCCCTGGAAGATTTCCACTCGAGTGGAAATCTTCCAGGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-29s21c1
Sequence:CCGGACGAGCAGCTGGAAGCGTATCCTCGAGGATACGCTTCCAGCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-284s21c1
Sequence:CCGGTTTCCGTGATGAGTGAAATGGCTCGAGCCATTTCACTCATCACGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-166s21c1
Sequence:CCGGTACGAGCTCATTGGCAGCATGCTCGAGCATGCTGCCAATGAGCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-432s21c1
Sequence:CCGGGGTGAGCCTGGTATGTGAGAACTCGAGTTCTCACATACCAGGCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-349s21c1
Sequence:CCGGTTTAACAACGACGACTACATTCTCGAGAATGTAGTCGTCGTTGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-214s21c1
Sequence:CCGGCAGAGGATTGCCCAGGTATTCCTCGAGGAATACCTGGGCAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-77s21c1
Sequence:CCGGAGATCATGAGGCTCTTCTATCCTCGAGGATAGAAGAGCCTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-310s21c1
Sequence:CCGGCGCGACCTCAAGGCTTACTATCTCGAGATAGTAAGCCTTGAGGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054113
CIB3 MISSION shRNA shRNA Plasmid DNA
calcium and integrin binding family member 3
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-43s1c1
Sequence:CCGGGCGTATCAGGACTGCACATTTCTCGAGAAATGTGCAGTCCTGATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-442s1c1
Sequence:CCGGGTATGTGAGAAGGTGCTGGATCTCGAGATCCAGCACCTTCTCACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-212s1c1
Sequence:CCGGGCCAGAGGATTGCCCAGGTATCTCGAGATACCTGGGCAATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-315s1c1
Sequence:CCGGCCTCAAGGCTTACTATGCTTTCTCGAGAAAGCATAGTAAGCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-494s1c1
Sequence:CCGGCCCTGGAAGATTTCCAGAACACTCGAGTGTTCTGGAAATCTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-489s21c1
Sequence:CCGGGCTGTCCCTGGAAGATTTCCACTCGAGTGGAAATCTTCCAGGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-29s21c1
Sequence:CCGGACGAGCAGCTGGAAGCGTATCCTCGAGGATACGCTTCCAGCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-284s21c1
Sequence:CCGGTTTCCGTGATGAGTGAAATGGCTCGAGCCATTTCACTCATCACGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-166s21c1
Sequence:CCGGTACGAGCTCATTGGCAGCATGCTCGAGCATGCTGCCAATGAGCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-432s21c1
Sequence:CCGGGGTGAGCCTGGTATGTGAGAACTCGAGTTCTCACATACCAGGCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-349s21c1
Sequence:CCGGTTTAACAACGACGACTACATTCTCGAGAATGTAGTCGTCGTTGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-214s21c1
Sequence:CCGGCAGAGGATTGCCCAGGTATTCCTCGAGGAATACCTGGGCAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-77s21c1
Sequence:CCGGAGATCATGAGGCTCTTCTATCCTCGAGGATAGAAGAGCCTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-310s21c1
Sequence:CCGGCGCGACCTCAAGGCTTACTATCTCGAGATAGTAAGCCTTGAGGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054113
CIB3 MISSION shRNA Lentiviral Transduction Particles
calcium and integrin binding family member 3
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-43s1c1
Sequence:CCGGGCGTATCAGGACTGCACATTTCTCGAGAAATGTGCAGTCCTGATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-442s1c1
Sequence:CCGGGTATGTGAGAAGGTGCTGGATCTCGAGATCCAGCACCTTCTCACATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-212s1c1
Sequence:CCGGGCCAGAGGATTGCCCAGGTATCTCGAGATACCTGGGCAATCCTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-315s1c1
Sequence:CCGGCCTCAAGGCTTACTATGCTTTCTCGAGAAAGCATAGTAAGCCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054113.2-494s1c1
Sequence:CCGGCCCTGGAAGATTTCCAGAACACTCGAGTGTTCTGGAAATCTTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-489s21c1
Sequence:CCGGGCTGTCCCTGGAAGATTTCCACTCGAGTGGAAATCTTCCAGGGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358602    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-29s21c1
Sequence:CCGGACGAGCAGCTGGAAGCGTATCCTCGAGGATACGCTTCCAGCTGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-284s21c1
Sequence:CCGGTTTCCGTGATGAGTGAAATGGCTCGAGCCATTTCACTCATCACGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-166s21c1
Sequence:CCGGTACGAGCTCATTGGCAGCATGCTCGAGCATGCTGCCAATGAGCTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232471    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-432s21c1
Sequence:CCGGGGTGAGCCTGGTATGTGAGAACTCGAGTTCTCACATACCAGGCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-349s21c1
Sequence:CCGGTTTAACAACGACGACTACATTCTCGAGAATGTAGTCGTCGTTGTTAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-214s21c1
Sequence:CCGGCAGAGGATTGCCCAGGTATTCCTCGAGGAATACCTGGGCAATCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232468    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-77s21c1
Sequence:CCGGAGATCATGAGGCTCTTCTATCCTCGAGGATAGAAGAGCCTCATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054113.2-310s21c1
Sequence:CCGGCGCGACCTCAAGGCTTACTATCTCGAGATAGTAAGCCTTGAGGTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080812
CIB3 MISSION shRNA Bacterial Glycerol Stock
calcium and integrin binding family member 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-470s21c1
Sequence:CCGGTGAAGCAGATGGAGACCAAGACTCGAGTCTTGGTCTCCATCTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-223s21c1
Sequence:CCGGAGAGAATTGCGCAGGTCTTCTCTCGAGAGAAGACCTGCGCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-271s21c1
Sequence:CCGGTAGAGAATTTCTTGGATATGTCTCGAGACATATCCAAGAAATTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-198s21c1
Sequence:CCGGGAGCTGAAGGATAACCCTTTCCTCGAGGAAAGGGTTATCCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-332s21c1
Sequence:CCGGCTACTATGCCTTCAAGATTTACTCGAGTAAATCTTGAAGGCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-422s21c1
Sequence:CCGGGGAACTGAGTGCTGAGGAAGTCTCGAGACTTCCTCAGCACTCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-365s21c1
Sequence:CCGGTGACAACTACATCTGTGCATGCTCGAGCATGCACAGATGTAGTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-128s21c1
Sequence:CCGGGTTGGTGCCTCTTGACTACACCTCGAGGTGTAGTCAAGAGGCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-158s21c1
Sequence:CCGGCAAGGTGAAGGTGCCCTATGACTCGAGTCATAGGGCACCTTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080812
CIB3 MISSION shRNA shRNA Plasmid DNA
calcium and integrin binding family member 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-470s21c1
Sequence:CCGGTGAAGCAGATGGAGACCAAGACTCGAGTCTTGGTCTCCATCTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-223s21c1
Sequence:CCGGAGAGAATTGCGCAGGTCTTCTCTCGAGAGAAGACCTGCGCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-271s21c1
Sequence:CCGGTAGAGAATTTCTTGGATATGTCTCGAGACATATCCAAGAAATTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-198s21c1
Sequence:CCGGGAGCTGAAGGATAACCCTTTCCTCGAGGAAAGGGTTATCCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-332s21c1
Sequence:CCGGCTACTATGCCTTCAAGATTTACTCGAGTAAATCTTGAAGGCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-422s21c1
Sequence:CCGGGGAACTGAGTGCTGAGGAAGTCTCGAGACTTCCTCAGCACTCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-365s21c1
Sequence:CCGGTGACAACTACATCTGTGCATGCTCGAGCATGCACAGATGTAGTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-128s21c1
Sequence:CCGGGTTGGTGCCTCTTGACTACACCTCGAGGTGTAGTCAAGAGGCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-158s21c1
Sequence:CCGGCAAGGTGAAGGTGCCCTATGACTCGAGTCATAGGGCACCTTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080812
CIB3 MISSION shRNA Lentiviral Transduction Particles
calcium and integrin binding family member 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-470s21c1
Sequence:CCGGTGAAGCAGATGGAGACCAAGACTCGAGTCTTGGTCTCCATCTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-223s21c1
Sequence:CCGGAGAGAATTGCGCAGGTCTTCTCTCGAGAGAAGACCTGCGCAATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-271s21c1
Sequence:CCGGTAGAGAATTTCTTGGATATGTCTCGAGACATATCCAAGAAATTCTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-198s21c1
Sequence:CCGGGAGCTGAAGGATAACCCTTTCCTCGAGGAAAGGGTTATCCTTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-332s21c1
Sequence:CCGGCTACTATGCCTTCAAGATTTACTCGAGTAAATCTTGAAGGCATAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-422s21c1
Sequence:CCGGGGAACTGAGTGCTGAGGAAGTCTCGAGACTTCCTCAGCACTCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-365s21c1
Sequence:CCGGTGACAACTACATCTGTGCATGCTCGAGCATGCACAGATGTAGTTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-128s21c1
Sequence:CCGGGTTGGTGCCTCTTGACTACACCTCGAGGTGTAGTCAAGAGGCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080812.1-158s21c1
Sequence:CCGGCAAGGTGAAGGTGCCCTATGACTCGAGTCATAGGGCACCTTCACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks