EMAIL THIS PAGE TO A FRIEND

CIB4

calcium and integrin binding family member 4

84 Gene Product Result for
Synonyms: KIP4
UniProtKB ID: A0PJX0, B2RU18
Gene ID:
Mouse(73259) calcium and integrin binding family member 4
Rat(688819) calcium and integrin binding family member 4
sheep(100303602) calcium and integrin binding family member 4
domestic guinea pig(100724392) calcium and integrin binding family member 4
naked mole-rat(101696447) calcium and integrin binding family member 4
cow(617324) calcium and integrin binding family member 4
domestic cat(101083000) calcium and integrin binding family member 4
Horse(100055658) calcium and integrin binding family member 4
dog(100687153) calcium and integrin binding family member 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001029881 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001029881 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001029881 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028483 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028483 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028483 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_059399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_059399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_059399 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001029881 Rosetta Predictions human pricing
XM_001068424 Rosetta Predictions rat pricing
XM_131990 Rosetta Predictions mouse pricing
XM_908365 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029881 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060684 predicted 208
2 SASI_Hs02_00307556 predicted 211
3 SASI_Hs02_00307557 predicted 234
4 SASI_Hs02_00307558 predicted 199
5 SASI_Hs02_00307559 predicted 220
6 SASI_Hs02_00307560 predicted 199
7 SASI_Hs01_00060691 predicted 222
8 SASI_Hs01_00060692 predicted 233
9 SASI_Hs02_00307561 predicted 200
10 SASI_Hs02_00307562 predicted 218
11 SASI_Hs01_00060685 predicted 464
12 SASI_Hs01_00060686 predicted 338
13 SASI_Hs01_00060687 predicted 478
14 SASI_Hs01_00060688 predicted 342
15 SASI_Hs01_00060689 predicted 229
16 SASI_Hs01_00060690 predicted 398
17 SASI_Hs01_00060693 predicted 321
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068424 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324457 predicted 392
2 SASI_Rn02_00324458 predicted 249
3 SASI_Rn02_00324459 predicted 311
4 SASI_Rn02_00324460 predicted 254
5 SASI_Rn02_00324461 predicted 226
6 SASI_Rn02_00324462 predicted 308
7 SASI_Rn02_00324463 predicted 357
8 SASI_Rn02_00324464 predicted 364
9 SASI_Rn02_00324465 predicted 193
10 SASI_Rn02_00324466 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_131990 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276825 predicted 354
2 SASI_Mm01_00276826 predicted 282
3 SASI_Mm02_00424454 predicted 257
4 SASI_Mm01_00276827 predicted 264
5 SASI_Mm01_00276828 predicted 387
6 SASI_Mm02_00424455 predicted 299
7 SASI_Mm02_00424456 predicted 313
8 SASI_Mm01_00276830 predicted 459
9 SASI_Mm01_00276831 predicted 417
10 SASI_Mm01_00276833 predicted 254
11 SASI_Mm01_00276829 predicted 523
12 SASI_Mm01_00276832 predicted 244
13 SASI_Mm01_00276834 predicted 244
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_908365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00434029 predicted 358
2 SASI_Mm02_00434030 predicted 281
3 SASI_Mm02_00434031 predicted 263
4 SASI_Mm02_00434032 predicted 393
5 SASI_Mm02_00434033 predicted 525
6 SASI_Mm02_00434034 predicted 455
7 SASI_Mm02_00434035 predicted 417
8 SASI_Mm02_00434036 predicted 235
9 SASI_Mm02_00434037 predicted 255
10 SASI_Mm02_00434038 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001029881
CIB4 MISSION shRNA Bacterial Glycerol Stock
calcium and integrin binding family member 4
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000367989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-335s21c1
Sequence:CCGGTGAGTATGCCTTTCGCATCTACTCGAGTAGATGCGAAAGGCATACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-475s21c1
Sequence:CCGGGTGAGTCGGATCTGGACAATGCTCGAGCATTGTCCAGATCCGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-87s21c1
Sequence:CCGGCTGACCTTCCTGACCAGAAATCTCGAGATTTCTGGTCAGGAAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-531s21c1
Sequence:CCGGATGGCCAAGTCTCCAGATTTCCTCGAGGAAATCTGGAGACTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001029881
CIB4 MISSION shRNA shRNA Plasmid DNA
calcium and integrin binding family member 4
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000367989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-335s21c1
Sequence:CCGGTGAGTATGCCTTTCGCATCTACTCGAGTAGATGCGAAAGGCATACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-475s21c1
Sequence:CCGGGTGAGTCGGATCTGGACAATGCTCGAGCATTGTCCAGATCCGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-87s21c1
Sequence:CCGGCTGACCTTCCTGACCAGAAATCTCGAGATTTCTGGTCAGGAAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-531s21c1
Sequence:CCGGATGGCCAAGTCTCCAGATTTCCTCGAGGAAATCTGGAGACTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001029881
CIB4 MISSION shRNA Lentiviral Transduction Particles
calcium and integrin binding family member 4
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000367989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-335s21c1
Sequence:CCGGTGAGTATGCCTTTCGCATCTACTCGAGTAGATGCGAAAGGCATACTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-475s21c1
Sequence:CCGGGTGAGTCGGATCTGGACAATGCTCGAGCATTGTCCAGATCCGACTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360207    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-87s21c1
Sequence:CCGGCTGACCTTCCTGACCAGAAATCTCGAGATTTCTGGTCAGGAAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001029881.1-531s21c1
Sequence:CCGGATGGCCAAGTCTCCAGATTTCCTCGAGGAAATCTGGAGACTTGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028483
CIB4 MISSION shRNA Bacterial Glycerol Stock
calcium and integrin binding family member 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-175s21c1
Sequence:CCGGCCCTCGGGCAAGCACTATAAGCTCGAGCTTATAGTGCTTGCCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-511s21c1
Sequence:CCGGGATCTGGACAATGACAGTATGCTCGAGCATACTGTCATTGTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-389s21c1
Sequence:CCGGTTAACGAGAATGGTTTCATTGCTCGAGCAATGAAACCATTCTCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-115s21c1
Sequence:CCGGCTGACCTTCCTGACAAGAAATCTCGAGATTTCTTGTCAGGAAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-260s21c1
Sequence:CCGGACCGCATCTGCAGGGTATTCTCTCGAGAGAATACCCTGCAGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028483
CIB4 MISSION shRNA shRNA Plasmid DNA
calcium and integrin binding family member 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-175s21c1
Sequence:CCGGCCCTCGGGCAAGCACTATAAGCTCGAGCTTATAGTGCTTGCCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-511s21c1
Sequence:CCGGGATCTGGACAATGACAGTATGCTCGAGCATACTGTCATTGTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-389s21c1
Sequence:CCGGTTAACGAGAATGGTTTCATTGCTCGAGCAATGAAACCATTCTCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-115s21c1
Sequence:CCGGCTGACCTTCCTGACAAGAAATCTCGAGATTTCTTGTCAGGAAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-260s21c1
Sequence:CCGGACCGCATCTGCAGGGTATTCTCTCGAGAGAATACCCTGCAGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028483
CIB4 MISSION shRNA Lentiviral Transduction Particles
calcium and integrin binding family member 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341607    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-175s21c1
Sequence:CCGGCCCTCGGGCAAGCACTATAAGCTCGAGCTTATAGTGCTTGCCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-511s21c1
Sequence:CCGGGATCTGGACAATGACAGTATGCTCGAGCATACTGTCATTGTCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-389s21c1
Sequence:CCGGTTAACGAGAATGGTTTCATTGCTCGAGCAATGAAACCATTCTCGTTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-115s21c1
Sequence:CCGGCTGACCTTCCTGACAAGAAATCTCGAGATTTCTTGTCAGGAAGGTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028483.1-260s21c1
Sequence:CCGGACCGCATCTGCAGGGTATTCTCTCGAGAGAATACCCTGCAGATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_059399
CIB4 MISSION shRNA Bacterial Glycerol Stock
calcium and integrin binding family member 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-101s1c1
Sequence:CCGGCAGAAATGAAATTCTGTGCATCTCGAGATGCACAGAATTTCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-491s1c1
Sequence:CCGGCAATGACAACATGCTGTCCTTCTCGAGAAGGACAGCATGTTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-543s1c1
Sequence:CCGGCCAGATTTCATGAACTCCTTTCTCGAGAAAGGAGTTCATGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-218s1c1
Sequence:CCGGCAACCCTTTCAGAGACCGTATCTCGAGATACGGTCTCTGAAAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000052669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-320s1c1
Sequence:CCGGCCCAAGCCTGAAGATTGAGTACTCGAGTACTCAATCTTCAGGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-101s1c2
Sequence:CCGGCAGAAATGAAATTCTGTGCATCTCGAGATGCACAGAATTTCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_059399
CIB4 MISSION shRNA shRNA Plasmid DNA
calcium and integrin binding family member 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-101s1c1
Sequence:CCGGCAGAAATGAAATTCTGTGCATCTCGAGATGCACAGAATTTCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-491s1c1
Sequence:CCGGCAATGACAACATGCTGTCCTTCTCGAGAAGGACAGCATGTTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-543s1c1
Sequence:CCGGCCAGATTTCATGAACTCCTTTCTCGAGAAAGGAGTTCATGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-218s1c1
Sequence:CCGGCAACCCTTTCAGAGACCGTATCTCGAGATACGGTCTCTGAAAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000052669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-320s1c1
Sequence:CCGGCCCAAGCCTGAAGATTGAGTACTCGAGTACTCAATCTTCAGGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-101s1c2
Sequence:CCGGCAGAAATGAAATTCTGTGCATCTCGAGATGCACAGAATTTCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_059399
CIB4 MISSION shRNA Lentiviral Transduction Particles
calcium and integrin binding family member 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-101s1c1
Sequence:CCGGCAGAAATGAAATTCTGTGCATCTCGAGATGCACAGAATTTCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-491s1c1
Sequence:CCGGCAATGACAACATGCTGTCCTTCTCGAGAAGGACAGCATGTTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-543s1c1
Sequence:CCGGCCAGATTTCATGAACTCCTTTCTCGAGAAAGGAGTTCATGAAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-218s1c1
Sequence:CCGGCAACCCTTTCAGAGACCGTATCTCGAGATACGGTCTCTGAAAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000052669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-320s1c1
Sequence:CCGGCCCAAGCCTGAAGATTGAGTACTCGAGTACTCAATCTTCAGGCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_059399.4-101s1c2
Sequence:CCGGCAGAAATGAAATTCTGTGCATCTCGAGATGCACAGAATTTCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks