EMAIL THIS PAGE TO A FRIEND

CIC

capicua transcriptional repressor

137 Gene Product Result for
UniProtKB ID: Q96RK0, Q7LGI1, Q9UEG5, Q9Y6T1
Gene ID:
Mouse(71722) capicua homolog (Drosophila)
Rat(308435) capicua transcriptional repressor
cow(538483) capicua transcriptional repressor
dog(484475) capicua homolog (Drosophila)
naked mole-rat(101714532) capicua transcriptional repressor
domestic guinea pig(100735811) capicua transcriptional repressor
sheep(101102258) capicua homolog (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108474 Anti-CIC IgG fraction of antiserum rat, guinea pig, bovine, rabbit, canine, pig, horse, human, mouse
immunohistochemistry, western blot pricing
SAB1303549 ANTI-CIC (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
immunohistochemistry, western blot pricing
AV32498 Anti-CIC antibody produced in rabbit IgG fraction of antiserum human, rabbit, rat, mouse, guinea pig, horse, bovine, canine
immunohistochemistry, western blot pricing
HPA044341 Anti-CIC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA064725 Anti-CIC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027882 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027882 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027882 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015125 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015125 Rosetta Predictions human pricing
NM_001107490 Rosetta Predictions rat pricing
NM_001110131 Rosetta Predictions mouse pricing
NM_001110132 Rosetta Predictions mouse pricing
NM_027882 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206025 predicted 4348
2 SASI_Hs01_00206026 predicted 832
3 SASI_Hs01_00206027 predicted 830
4 SASI_Hs01_00206028 predicted 3507
5 SASI_Hs01_00206029 predicted 2050
6 SASI_Hs01_00206030 predicted 1415
7 SASI_Hs01_00206032 predicted 1521
8 SASI_Hs01_00206033 predicted 4347
9 SASI_Hs02_00347035 predicted 4339
10 SASI_Hs02_00347036 predicted 4043
11 SASI_Hs01_00206024 predicted 2503
12 SASI_Hs01_00206031 predicted 4127
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229345 predicted 2812
2 SASI_Rn02_00229346 predicted 206
3 SASI_Rn02_00229347 predicted 2450
4 SASI_Rn02_00229348 predicted 1369
5 SASI_Rn02_00229349 predicted 1378
6 SASI_Rn02_00229350 predicted 4494
7 SASI_Rn02_00229351 predicted 4477
8 SASI_Rn02_00229352 predicted 326
9 SASI_Rn02_00229353 predicted 2869
10 SASI_Rn02_00229354 predicted 1489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110131 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304666 predicted 3490
2 SASI_Mm02_00304667 predicted 3614
3 SASI_Mm02_00304668 predicted 3123
4 SASI_Mm02_00304669 predicted 5146
5 SASI_Mm02_00304670 predicted 1815
6 SASI_Mm02_00304671 predicted 1131
7 SASI_Mm02_00304672 predicted 1000
8 SASI_Mm02_00304673 predicted 2052
9 SASI_Mm02_00304674 predicted 1282
10 SASI_Mm02_00304675 predicted 2888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304676 predicted 3489
2 SASI_Mm02_00304677 predicted 3608
3 SASI_Mm02_00304678 predicted 3125
4 SASI_Mm02_00304679 predicted 5147
5 SASI_Mm02_00304680 predicted 1818
6 SASI_Mm02_00304681 predicted 1124
7 SASI_Mm02_00304682 predicted 1001
8 SASI_Mm02_00304683 predicted 2053
9 SASI_Mm02_00304684 predicted 1286
10 SASI_Mm02_00304685 predicted 2888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027882 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163415 predicted 3494
2 SASI_Mm01_00163416 predicted 3608
3 SASI_Mm01_00163418 predicted 3124
4 SASI_Mm01_00163419 predicted 5145
5 SASI_Mm01_00163420 predicted 1813
6 SASI_Mm01_00163421 predicted 1128
7 SASI_Mm01_00163422 predicted 999
8 SASI_Mm01_00163423 predicted 2048
9 SASI_Mm02_00332843 predicted 1285
10 SASI_Mm02_00332844 predicted 2882
11 SASI_Mm01_00163417 predicted 4082
12 SASI_Mm01_00163424 predicted 4220
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027882
VALIDATED
CIC MISSION shRNA Bacterial Glycerol Stock
capicua transcriptional repressor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000082008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027882.2-4902s1c1
Sequence:CCGGCCTCAGGATATGGACAGTATACTCGAGTATACTGTCCATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027882.2-4091s1c1
Sequence:CCGGGTGGACTTTGAAGAGCGGTTTCTCGAGAAACCGCTCTTCAAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027882.2-1422s1c1
Sequence:CCGGCCGACATTGATCTCAAGTGCACTCGAGTGCACTTGAGATCAATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027882.2-573s1c1
Sequence:CCGGCCAAGGAACGAGACTCATCTTCTCGAGAAGATGAGTCTCGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000082009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027882.2-2904s1c1
Sequence:CCGGCCCAACAACCTAGCAAGATTACTCGAGTAATCTTGCTAGGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-1204s21c1
Sequence:CCGGCCAAGGAACGAGACTCATCTTCTCGAGAAGATGAGTCTCGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-5781s21c1
Sequence:CCGGTGCAAGCTGGAGGGTAGTATGCTCGAGCATACTACCCTCCAGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-4716s21c1
Sequence:CCGGGTGGACTTTGAAGAGCGGTTTCTCGAGAAACCGCTCTTCAAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-2053s21c1
Sequence:CCGGCCGACATTGATCTCAAGTGCACTCGAGTGCACTTGAGATCAATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027882.3-1252s21c1
Sequence:CCGGAGCGGGAGAAGGACCATATTCCTCGAGGAATATGGTCCTTCTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027882
VALIDATED
CIC MISSION shRNA shRNA Plasmid DNA
capicua transcriptional repressor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000082008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027882.2-4902s1c1
Sequence:CCGGCCTCAGGATATGGACAGTATACTCGAGTATACTGTCCATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027882.2-4091s1c1
Sequence:CCGGGTGGACTTTGAAGAGCGGTTTCTCGAGAAACCGCTCTTCAAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027882.2-1422s1c1
Sequence:CCGGCCGACATTGATCTCAAGTGCACTCGAGTGCACTTGAGATCAATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027882.2-573s1c1
Sequence:CCGGCCAAGGAACGAGACTCATCTTCTCGAGAAGATGAGTCTCGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000082009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027882.2-2904s1c1
Sequence:CCGGCCCAACAACCTAGCAAGATTACTCGAGTAATCTTGCTAGGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-1204s21c1
Sequence:CCGGCCAAGGAACGAGACTCATCTTCTCGAGAAGATGAGTCTCGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-5781s21c1
Sequence:CCGGTGCAAGCTGGAGGGTAGTATGCTCGAGCATACTACCCTCCAGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-4716s21c1
Sequence:CCGGGTGGACTTTGAAGAGCGGTTTCTCGAGAAACCGCTCTTCAAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-2053s21c1
Sequence:CCGGCCGACATTGATCTCAAGTGCACTCGAGTGCACTTGAGATCAATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027882.3-1252s21c1
Sequence:CCGGAGCGGGAGAAGGACCATATTCCTCGAGGAATATGGTCCTTCTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027882
VALIDATED
CIC MISSION shRNA Lentiviral Transduction Particles
capicua transcriptional repressor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000082008    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027882.2-4902s1c1
Sequence:CCGGCCTCAGGATATGGACAGTATACTCGAGTATACTGTCCATATCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027882.2-4091s1c1
Sequence:CCGGGTGGACTTTGAAGAGCGGTTTCTCGAGAAACCGCTCTTCAAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027882.2-1422s1c1
Sequence:CCGGCCGACATTGATCTCAAGTGCACTCGAGTGCACTTGAGATCAATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027882.2-573s1c1
Sequence:CCGGCCAAGGAACGAGACTCATCTTCTCGAGAAGATGAGTCTCGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000082009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027882.2-2904s1c1
Sequence:CCGGCCCAACAACCTAGCAAGATTACTCGAGTAATCTTGCTAGGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-1204s21c1
Sequence:CCGGCCAAGGAACGAGACTCATCTTCTCGAGAAGATGAGTCTCGTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304641    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-5781s21c1
Sequence:CCGGTGCAAGCTGGAGGGTAGTATGCTCGAGCATACTACCCTCCAGCTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302126    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-4716s21c1
Sequence:CCGGGTGGACTTTGAAGAGCGGTTTCTCGAGAAACCGCTCTTCAAAGTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302060    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027882.3-2053s21c1
Sequence:CCGGCCGACATTGATCTCAAGTGCACTCGAGTGCACTTGAGATCAATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027882.3-1252s21c1
Sequence:CCGGAGCGGGAGAAGGACCATATTCCTCGAGGAATATGGTCCTTCTCCCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015125
VALIDATED
CIC MISSION shRNA Bacterial Glycerol Stock
capicua transcriptional repressor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015125.2-2218s1c1
Sequence:CCGGCTTAGTGTATTCGGACAAGAACTCGAGTTCTTGTCCGAATACACTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-4198s1c1
Sequence:CCGGCCTGGGCTCTTACCGCAAGAACTCGAGTTCTTGCGGTAAGAGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-1604s1c1
Sequence:CCGGGTAGCCTTTGGCAAAGGCTATCTCGAGATAGCCTTTGCCAAAGGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-835s1c1
Sequence:CCGGAGATTGGAAGTGGTGCAACAACTCGAGTTGTTGCACCACTTCCAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-4114s1c1
Sequence:CCGGCTTTGCTGAGTTGCCTGAGTTCTCGAGAACTCAGGCAACTCAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015125.3-4878s21c1
Sequence:CCGGAGAAGATGCCAGGACTTATAGCTCGAGCTATAAGTCCTGGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-3827s21c1
Sequence:CCGGGAGACCATGGCCAGCAAATTCCTCGAGGAATTTGCTGGCCATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-4198s21c1
Sequence:CCGGCCTGGGCTCTTACCGCAAGAACTCGAGTTCTTGCGGTAAGAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-2218s21c1
Sequence:CCGGCTTAGTGTATTCGGACAAGAACTCGAGTTCTTGTCCGAATACACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-4114s21c1
Sequence:CCGGCTTTGCTGAGTTGCCTGAGTTCTCGAGAACTCAGGCAACTCAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015125
VALIDATED
CIC MISSION shRNA shRNA Plasmid DNA
capicua transcriptional repressor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015125.2-2218s1c1
Sequence:CCGGCTTAGTGTATTCGGACAAGAACTCGAGTTCTTGTCCGAATACACTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-4198s1c1
Sequence:CCGGCCTGGGCTCTTACCGCAAGAACTCGAGTTCTTGCGGTAAGAGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-1604s1c1
Sequence:CCGGGTAGCCTTTGGCAAAGGCTATCTCGAGATAGCCTTTGCCAAAGGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-835s1c1
Sequence:CCGGAGATTGGAAGTGGTGCAACAACTCGAGTTGTTGCACCACTTCCAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-4114s1c1
Sequence:CCGGCTTTGCTGAGTTGCCTGAGTTCTCGAGAACTCAGGCAACTCAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015125.3-4878s21c1
Sequence:CCGGAGAAGATGCCAGGACTTATAGCTCGAGCTATAAGTCCTGGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-3827s21c1
Sequence:CCGGGAGACCATGGCCAGCAAATTCCTCGAGGAATTTGCTGGCCATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-4198s21c1
Sequence:CCGGCCTGGGCTCTTACCGCAAGAACTCGAGTTCTTGCGGTAAGAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-2218s21c1
Sequence:CCGGCTTAGTGTATTCGGACAAGAACTCGAGTTCTTGTCCGAATACACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-4114s21c1
Sequence:CCGGCTTTGCTGAGTTGCCTGAGTTCTCGAGAACTCAGGCAACTCAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015125
VALIDATED
CIC MISSION shRNA Lentiviral Transduction Particles
capicua transcriptional repressor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018920    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_015125.2-2218s1c1
Sequence:CCGGCTTAGTGTATTCGGACAAGAACTCGAGTTCTTGTCCGAATACACTAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-4198s1c1
Sequence:CCGGCCTGGGCTCTTACCGCAAGAACTCGAGTTCTTGCGGTAAGAGCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-1604s1c1
Sequence:CCGGGTAGCCTTTGGCAAAGGCTATCTCGAGATAGCCTTTGCCAAAGGCTACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-835s1c1
Sequence:CCGGAGATTGGAAGTGGTGCAACAACTCGAGTTGTTGCACCACTTCCAATCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015125.2-4114s1c1
Sequence:CCGGCTTTGCTGAGTTGCCTGAGTTCTCGAGAACTCAGGCAACTCAGCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329970    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015125.3-4878s21c1
Sequence:CCGGAGAAGATGCCAGGACTTATAGCTCGAGCTATAAGTCCTGGCATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-3827s21c1
Sequence:CCGGGAGACCATGGCCAGCAAATTCCTCGAGGAATTTGCTGGCCATGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329969    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-4198s21c1
Sequence:CCGGCCTGGGCTCTTACCGCAAGAACTCGAGTTCTTGCGGTAAGAGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-2218s21c1
Sequence:CCGGCTTAGTGTATTCGGACAAGAACTCGAGTTCTTGTCCGAATACACTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015125.3-4114s21c1
Sequence:CCGGCTTTGCTGAGTTGCCTGAGTTCTCGAGAACTCAGGCAACTCAGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks