EMAIL THIS PAGE TO A FRIEND

CIDEA

cell death-inducing DFFA-like effector a

Synonyms: CIDE-A
UniProtKB ID: O60543, B0YIY7, Q6UPR7
Gene ID:
Human(1149) Summary: This gene encodes the homolog of the mouse protein Cidea that has been shown to activate apoptosis. This activation of apoptosis is inhibited by the DNA fragmentation factor DFF45 but not by caspase inhibitors. Mice that lack functional Cidea have higher metabolic rates, higher lipolysis in brown adipose tissue and higher core body temperatures when subjected to cold. These mice are also resistant to diet-induced obesity and diabetes. This suggests that in mice this gene product plays a role in thermogenesis and lipolysis. Alternatively spliced transcripts have been identified. [provided by RefSeq, Aug 2010]
Mouse(12683) cell death-inducing DNA fragmentation factor, alpha subunit-like effector A
Rat(291541) cell death-inducing DFFA-like effector a
Zebrafish(100536460) cell death-inducing DFFA-like effector a
cow(527051) cell death-inducing DFFA-like effector a
domestic cat(101096676) cell death-inducing DFFA-like effector a
dog(490559) cell death-inducing DFFA-like effector a
chicken(768659) cell death-inducing DFFA-like effector a
sheep(101108619) cell death-inducing DFFA-like effector a
domestic guinea pig(100733762) cell death-inducing DFFA-like effector a
naked mole-rat(101719851) cell death-inducing DFFA-like effector a
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007702 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007702 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007702 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001279 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001279 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001279 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001279 Rosetta Predictions human pricing
NM_198289 Rosetta Predictions human pricing
XM_214551 Rosetta Predictions rat pricing
NM_007702 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001279 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331500 predicted 749
2 SASI_Hs02_00331501 predicted 739
3 SASI_Hs02_00331502 predicted 610
4 SASI_Hs02_00331503 predicted 750
5 SASI_Hs01_00130944 predicted 344
6 SASI_Hs01_00130945 predicted 445
7 SASI_Hs02_00331504 predicted 445
8 SASI_Hs02_00331505 predicted 774
9 SASI_Hs02_00331506 predicted 708
10 SASI_Hs02_00331507 predicted 759
11 SASI_Hs01_00130941 predicted 553
12 SASI_Hs01_00130942 predicted 439
13 SASI_Hs01_00130943 predicted 402
14 SASI_Hs01_00130946 predicted 273
15 SASI_Hs01_00130947 predicted 459
16 SASI_Hs01_00130948 predicted 545
17 SASI_Hs01_00130949 predicted 511
18 SASI_Hs01_00130950 predicted 279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198289 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128866 predicted 978
2 SASI_Hs02_00371857 predicted 966
3 SASI_Hs02_00371858 predicted 840
4 SASI_Hs01_00128868 predicted 976
5 SASI_Hs01_00128869 predicted 561
6 SASI_Hs01_00128870 predicted 672
7 SASI_Hs01_00128871 predicted 674
8 SASI_Hs01_00128872 predicted 997
9 SASI_Hs01_00128873 predicted 929
10 SASI_Hs01_00128874 predicted 988
11 SASI_Hs01_00128867 predicted 824
12 SASI_Hs01_00128875 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375415 predicted 261
2 SASI_Rn02_00375416 predicted 267
3 SASI_Rn02_00375417 predicted 252
4 SASI_Rn02_00375418 predicted 1066
5 SASI_Rn02_00375419 predicted 723
6 SASI_Rn02_00375420 predicted 1186
7 SASI_Rn02_00375421 predicted 1045
8 SASI_Rn02_00375422 predicted 846
9 SASI_Rn02_00375423 predicted 821
10 SASI_Rn02_00375424 predicted 364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007702 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068874 predicted 823
2 SASI_Mm01_00068875 predicted 547
3 SASI_Mm01_00068876 predicted 750
4 SASI_Mm01_00068877 predicted 416
5 SASI_Mm01_00068878 predicted 615
6 SASI_Mm01_00068879 predicted 862
7 SASI_Mm01_00068880 predicted 794
8 SASI_Mm01_00068881 predicted 587
9 SASI_Mm01_00068882 predicted 811
10 SASI_Mm02_00312263 predicted 711
11 SASI_Mm01_00068883 predicted 714
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007702
CIDEA MISSION shRNA Bacterial Glycerol Stock
cell death-inducing DFFA-like effector a
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-620s21c1
Sequence:CCGGCAGAGTCACCTTCGACCTATACTCGAGTATAGGTCGAAGGTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-802s21c1
Sequence:CCGGTGGTCTATGCGGGCACATACACTCGAGTGTATGTGCCCGCATAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-597s21c1
Sequence:CCGGCAACCAAAGAAATCGGGAATACTCGAGTATTCCCGATTTCTTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-702s21c1
Sequence:CCGGTACTCGGTGTCCTACGACATCCTCGAGGATGTCGTAGGACACCGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-515s21c1
Sequence:CCGGCTTAAGGGACAACACGCATTTCTCGAGAAATGCGTGTTGTCCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-264s1c1
Sequence:CCGGCATGGGATTGCAGACTAAGAACTCGAGTTCTTAGTCTGCAATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-273s1c1
Sequence:CCGGGCAGACTAAGAAGGTCCTACTCTCGAGAGTAGGACCTTCTTAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-325s1c1
Sequence:CCGGCGAGTTTCAAACCATGACCGACTCGAGTCGGTCATGGTTTGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-531s1c1
Sequence:CCGGGAAATGGACACCGGGTAGTAACTCGAGTTACTACCCGGTGTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007702
CIDEA MISSION shRNA shRNA Plasmid DNA
cell death-inducing DFFA-like effector a
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-620s21c1
Sequence:CCGGCAGAGTCACCTTCGACCTATACTCGAGTATAGGTCGAAGGTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-802s21c1
Sequence:CCGGTGGTCTATGCGGGCACATACACTCGAGTGTATGTGCCCGCATAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-597s21c1
Sequence:CCGGCAACCAAAGAAATCGGGAATACTCGAGTATTCCCGATTTCTTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-702s21c1
Sequence:CCGGTACTCGGTGTCCTACGACATCCTCGAGGATGTCGTAGGACACCGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-515s21c1
Sequence:CCGGCTTAAGGGACAACACGCATTTCTCGAGAAATGCGTGTTGTCCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-264s1c1
Sequence:CCGGCATGGGATTGCAGACTAAGAACTCGAGTTCTTAGTCTGCAATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-273s1c1
Sequence:CCGGGCAGACTAAGAAGGTCCTACTCTCGAGAGTAGGACCTTCTTAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-325s1c1
Sequence:CCGGCGAGTTTCAAACCATGACCGACTCGAGTCGGTCATGGTTTGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-531s1c1
Sequence:CCGGGAAATGGACACCGGGTAGTAACTCGAGTTACTACCCGGTGTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007702
CIDEA MISSION shRNA Lentiviral Transduction Particles
cell death-inducing DFFA-like effector a
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-620s21c1
Sequence:CCGGCAGAGTCACCTTCGACCTATACTCGAGTATAGGTCGAAGGTGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-802s21c1
Sequence:CCGGTGGTCTATGCGGGCACATACACTCGAGTGTATGTGCCCGCATAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433750    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-597s21c1
Sequence:CCGGCAACCAAAGAAATCGGGAATACTCGAGTATTCCCGATTTCTTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-702s21c1
Sequence:CCGGTACTCGGTGTCCTACGACATCCTCGAGGATGTCGTAGGACACCGAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433315    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007702.2-515s21c1
Sequence:CCGGCTTAAGGGACAACACGCATTTCTCGAGAAATGCGTGTTGTCCCTTAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180007    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-264s1c1
Sequence:CCGGCATGGGATTGCAGACTAAGAACTCGAGTTCTTAGTCTGCAATCCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-273s1c1
Sequence:CCGGGCAGACTAAGAAGGTCCTACTCTCGAGAGTAGGACCTTCTTAGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-325s1c1
Sequence:CCGGCGAGTTTCAAACCATGACCGACTCGAGTCGGTCATGGTTTGAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007702.1-531s1c1
Sequence:CCGGGAAATGGACACCGGGTAGTAACTCGAGTTACTACCCGGTGTCCATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001279
CIDEA MISSION shRNA Bacterial Glycerol Stock
cell death-inducing DFFA-like effector a
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000163968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-185s1c1
Sequence:CCGGCTCATCAGCAAGACTCTGGATCTCGAGATCCAGAGTCTTGCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-562s1c1
Sequence:CCGGGACGGGACAGTTTCTCATCTACTCGAGTAGATGAGAAACTGTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-298s1c1
Sequence:CCGGCAACACGCATTTCATGATCTTCTCGAGAAGATCATGAAATGCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-303s1c1
Sequence:CCGGCGCATTTCATGATCTTGGAAACTCGAGTTTCCAAGATCATGAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001279.2-729s1c1
Sequence:CCGGGACGAATGTTGAAGATGCTTTCTCGAGAAAGCATCTTCAACATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-700s1c1
Sequence:CCGGGCCAAACACTGTGTTTCGTTTCTCGAGAAACGAAACACAGTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-55s1c1
Sequence:CCGGCCTGACATTTATGGGATCACACTCGAGTGTGATCCCATAAATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-394s1c1
Sequence:CCGGGAGAGTCACCTTCGACTTGTACTCGAGTACAAGTCGAAGGTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-695s1c1
Sequence:CCGGCTTGAGCCAAACACTGTGTTTCTCGAGAAACACAGTGTTTGGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001279
CIDEA MISSION shRNA shRNA Plasmid DNA
cell death-inducing DFFA-like effector a
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000163968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-185s1c1
Sequence:CCGGCTCATCAGCAAGACTCTGGATCTCGAGATCCAGAGTCTTGCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-562s1c1
Sequence:CCGGGACGGGACAGTTTCTCATCTACTCGAGTAGATGAGAAACTGTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-298s1c1
Sequence:CCGGCAACACGCATTTCATGATCTTCTCGAGAAGATCATGAAATGCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-303s1c1
Sequence:CCGGCGCATTTCATGATCTTGGAAACTCGAGTTTCCAAGATCATGAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001279.2-729s1c1
Sequence:CCGGGACGAATGTTGAAGATGCTTTCTCGAGAAAGCATCTTCAACATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-700s1c1
Sequence:CCGGGCCAAACACTGTGTTTCGTTTCTCGAGAAACGAAACACAGTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-55s1c1
Sequence:CCGGCCTGACATTTATGGGATCACACTCGAGTGTGATCCCATAAATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-394s1c1
Sequence:CCGGGAGAGTCACCTTCGACTTGTACTCGAGTACAAGTCGAAGGTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-695s1c1
Sequence:CCGGCTTGAGCCAAACACTGTGTTTCTCGAGAAACACAGTGTTTGGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001279
CIDEA MISSION shRNA Lentiviral Transduction Particles
cell death-inducing DFFA-like effector a
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000163968    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-185s1c1
Sequence:CCGGCTCATCAGCAAGACTCTGGATCTCGAGATCCAGAGTCTTGCTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163093    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-562s1c1
Sequence:CCGGGACGGGACAGTTTCTCATCTACTCGAGTAGATGAGAAACTGTCCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158513    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-298s1c1
Sequence:CCGGCAACACGCATTTCATGATCTTCTCGAGAAGATCATGAAATGCGTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-303s1c1
Sequence:CCGGCGCATTTCATGATCTTGGAAACTCGAGTTTCCAAGATCATGAAATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159027    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001279.2-729s1c1
Sequence:CCGGGACGAATGTTGAAGATGCTTTCTCGAGAAAGCATCTTCAACATTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161381    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-700s1c1
Sequence:CCGGGCCAAACACTGTGTTTCGTTTCTCGAGAAACGAAACACAGTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-55s1c1
Sequence:CCGGCCTGACATTTATGGGATCACACTCGAGTGTGATCCCATAAATGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162991    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-394s1c1
Sequence:CCGGGAGAGTCACCTTCGACTTGTACTCGAGTACAAGTCGAAGGTGACTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001279.2-695s1c1
Sequence:CCGGCTTGAGCCAAACACTGTGTTTCTCGAGAAACACAGTGTTTGGCTCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks