EMAIL THIS PAGE TO A FRIEND

CIDEC

cell death-inducing DFFA-like effector c

58 Gene Product Result for
Synonyms: CIDE-3 CIDE3 FPLD5 FSP27
UniProtKB ID: Q96AQ7, C9JMN7, Q67DW9, Q9GZY9
Gene ID:
Human(63924) Summary: This gene encodes a member of the cell death-inducing DNA fragmentation factor-like effector family. Members of this family play important roles in apoptosis. The encoded protein promotes lipid droplet formation in adipocytes and may mediate adipocyte apoptosis. This gene is regulated by insulin and its expression is positively correlated with insulin sensitivity. Mutations in this gene may contribute to insulin resistant diabetes. A pseudogene of this gene is located on the short arm of chromosome 3. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
Mouse(14311) cell death-inducing DFFA-like effector c
Rat(500292) cell death-inducing DFFA-like effector c
chicken(100859733) cell death-inducing DFFA-like effector c
dog(484662) cell death-inducing DFFA-like effector c
cow(534607) cell death-inducing DFFA-like effector c
domestic cat(101085612) cell death-inducing DFFA-like effector c
sheep(101102430) cell death-inducing DFFA-like effector c
domestic guinea pig(100730322) cell death-inducing DFFA-like effector c
naked mole-rat(101699734) cell death-inducing DFFA-like effector c
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022094 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178373 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178373 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178373 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111051 MISSION® esiRNA esiRNA human CIDEC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022094 Rosetta Predictions human pricing
NM_001024333 Rosetta Predictions rat pricing
NM_178373 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112594 predicted 201
2 SASI_Hs01_00112595 predicted 451
3 SASI_Hs01_00112596 predicted 560
4 SASI_Hs01_00112597 predicted 338
5 SASI_Hs01_00112598 predicted 388
6 SASI_Hs01_00112599 predicted 559
7 SASI_Hs01_00112600 predicted 814
8 SASI_Hs01_00112601 predicted 309
9 SASI_Hs01_00112602 predicted 409
10 SASI_Hs01_00112603 predicted 354
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024333 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00110542 predicted 473
2 SASI_Rn01_00110543 predicted 473
3 SASI_Rn01_00110546 predicted 950
4 SASI_Rn01_00110548 predicted 349
5 SASI_Rn01_00110550 predicted 650
6 SASI_Rn02_00202554 predicted 197
7 SASI_Rn01_00110551 predicted 541
8 SASI_Rn02_00202555 predicted 648
9 SASI_Rn02_00202556 predicted 309
10 SASI_Rn02_00202557 predicted 311
11 SASI_Rn01_00110544 predicted 595
12 SASI_Rn01_00110545 predicted 255
13 SASI_Rn01_00110547 predicted 595
14 SASI_Rn01_00110549 predicted 479
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178373 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118727 predicted 1211
2 SASI_Mm01_00118728 predicted 363
3 SASI_Mm01_00118729 predicted 1202
4 SASI_Mm02_00348770 predicted 555
5 SASI_Mm01_00118732 predicted 1232
6 SASI_Mm01_00118733 predicted 749
7 SASI_Mm01_00118734 predicted 462
8 SASI_Mm01_00118736 predicted 1204
9 SASI_Mm02_00348771 predicted 1204
10 SASI_Mm02_00348772 predicted 550
11 SASI_Mm01_00118730 predicted 254
12 SASI_Mm01_00118731 predicted 1015
13 SASI_Mm01_00118735 predicted 321
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022094
CIDEC MISSION shRNA Bacterial Glycerol Stock
cell death-inducing DFFA-like effector c
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-314s1c1
Sequence:CCGGCATGGCTTACAGTCTTGAGGACTCGAGTCCTCAAGACTGTAAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-835s1c1
Sequence:CCGGCCTGTCTGAAGATACTGCAGTCTCGAGACTGCAGTATCTTCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-639s1c1
Sequence:CCGGGATACATACTCCCTTTCCTATCTCGAGATAGGAAAGGGAGTATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-572s1c1
Sequence:CCGGGTTTGATCTGTACAAGCTGAACTCGAGTTCAGCTTGTACAGATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-417s1c1
Sequence:CCGGGAGACAGAAGAGTACTTCCAACTCGAGTTGGAAGTACTCTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-576s1c1
Sequence:CCGGGATCTGTACAAGCTGAACCCACTCGAGTGGGTTCAGCTTGTACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-396s1c1
Sequence:CCGGGAGGAAGATGGCACAACTGTACTCGAGTACAGTTGTGCCATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-683s1c1
Sequence:CCGGGCGCATCATGAAGGAAGCTTTCTCGAGAAAGCTTCCTTCATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-649s1c1
Sequence:CCGGCCCTTTCCTATGATCTGCACTCTCGAGAGTGCAGATCATAGGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022094
CIDEC MISSION shRNA shRNA Plasmid DNA
cell death-inducing DFFA-like effector c
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-314s1c1
Sequence:CCGGCATGGCTTACAGTCTTGAGGACTCGAGTCCTCAAGACTGTAAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-835s1c1
Sequence:CCGGCCTGTCTGAAGATACTGCAGTCTCGAGACTGCAGTATCTTCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-639s1c1
Sequence:CCGGGATACATACTCCCTTTCCTATCTCGAGATAGGAAAGGGAGTATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-572s1c1
Sequence:CCGGGTTTGATCTGTACAAGCTGAACTCGAGTTCAGCTTGTACAGATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-417s1c1
Sequence:CCGGGAGACAGAAGAGTACTTCCAACTCGAGTTGGAAGTACTCTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-576s1c1
Sequence:CCGGGATCTGTACAAGCTGAACCCACTCGAGTGGGTTCAGCTTGTACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-396s1c1
Sequence:CCGGGAGGAAGATGGCACAACTGTACTCGAGTACAGTTGTGCCATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-683s1c1
Sequence:CCGGGCGCATCATGAAGGAAGCTTTCTCGAGAAAGCTTCCTTCATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-649s1c1
Sequence:CCGGCCCTTTCCTATGATCTGCACTCTCGAGAGTGCAGATCATAGGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022094
CIDEC MISSION shRNA Lentiviral Transduction Particles
cell death-inducing DFFA-like effector c
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-314s1c1
Sequence:CCGGCATGGCTTACAGTCTTGAGGACTCGAGTCCTCAAGACTGTAAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155400    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-835s1c1
Sequence:CCGGCCTGTCTGAAGATACTGCAGTCTCGAGACTGCAGTATCTTCAGACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-639s1c1
Sequence:CCGGGATACATACTCCCTTTCCTATCTCGAGATAGGAAAGGGAGTATGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151104    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-572s1c1
Sequence:CCGGGTTTGATCTGTACAAGCTGAACTCGAGTTCAGCTTGTACAGATCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-417s1c1
Sequence:CCGGGAGACAGAAGAGTACTTCCAACTCGAGTTGGAAGTACTCTTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-576s1c1
Sequence:CCGGGATCTGTACAAGCTGAACCCACTCGAGTGGGTTCAGCTTGTACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-396s1c1
Sequence:CCGGGAGGAAGATGGCACAACTGTACTCGAGTACAGTTGTGCCATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022094.2-683s1c1
Sequence:CCGGGCGCATCATGAAGGAAGCTTTCTCGAGAAAGCTTCCTTCATGATGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155669    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022094.2-649s1c1
Sequence:CCGGCCCTTTCCTATGATCTGCACTCTCGAGAGTGCAGATCATAGGAAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178373
CIDEC MISSION shRNA Bacterial Glycerol Stock
cell death-inducing DFFA-like effector c
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178373.2-577s1c1
Sequence:CCGGCTATGACCTGCACTGCTACAACTCGAGTTGTAGCAGTGCAGGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178373.2-549s1c1
Sequence:CCGGCAACCCTCTATGACACATACTCTCGAGAGTATGTGTCATAGAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178373.2-1507s1c1
Sequence:CCGGCCCTCCTGTAAGTAACCTAAACTCGAGTTTAGGTTACTTACAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178373.2-269s1c1
Sequence:CCGGCAGGACATCTTGAAACTTAAACTCGAGTTTAAGTTTCAAGATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178373.3-1157s21c1
Sequence:CCGGCATCATACCTTGGCCTGAATCCTCGAGGATTCAGGCCAAGGTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178373.3-410s21c1
Sequence:CCGGCCCATCAGAACAGCGCAAGAACTCGAGTTCTTGCGCTGTTCTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178373.3-1123s21c1
Sequence:CCGGCTCATCATGCAGTAGACATTACTCGAGTAATGTCTACTGCATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178373.3-1002s21c1
Sequence:CCGGGCTTAGAGGACTAACACTTAGCTCGAGCTAAGTGTTAGTCCTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178373
CIDEC MISSION shRNA shRNA Plasmid DNA
cell death-inducing DFFA-like effector c
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178373.2-577s1c1
Sequence:CCGGCTATGACCTGCACTGCTACAACTCGAGTTGTAGCAGTGCAGGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178373.2-549s1c1
Sequence:CCGGCAACCCTCTATGACACATACTCTCGAGAGTATGTGTCATAGAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178373.2-1507s1c1
Sequence:CCGGCCCTCCTGTAAGTAACCTAAACTCGAGTTTAGGTTACTTACAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178373.2-269s1c1
Sequence:CCGGCAGGACATCTTGAAACTTAAACTCGAGTTTAAGTTTCAAGATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178373.3-1157s21c1
Sequence:CCGGCATCATACCTTGGCCTGAATCCTCGAGGATTCAGGCCAAGGTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178373.3-410s21c1
Sequence:CCGGCCCATCAGAACAGCGCAAGAACTCGAGTTCTTGCGCTGTTCTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178373.3-1123s21c1
Sequence:CCGGCTCATCATGCAGTAGACATTACTCGAGTAATGTCTACTGCATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178373.3-1002s21c1
Sequence:CCGGGCTTAGAGGACTAACACTTAGCTCGAGCTAAGTGTTAGTCCTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178373
CIDEC MISSION shRNA Lentiviral Transduction Particles
cell death-inducing DFFA-like effector c
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178373.2-577s1c1
Sequence:CCGGCTATGACCTGCACTGCTACAACTCGAGTTGTAGCAGTGCAGGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178373.2-549s1c1
Sequence:CCGGCAACCCTCTATGACACATACTCTCGAGAGTATGTGTCATAGAGGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201011    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178373.2-1507s1c1
Sequence:CCGGCCCTCCTGTAAGTAACCTAAACTCGAGTTTAGGTTACTTACAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178373.2-269s1c1
Sequence:CCGGCAGGACATCTTGAAACTTAAACTCGAGTTTAAGTTTCAAGATGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439503    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178373.3-1157s21c1
Sequence:CCGGCATCATACCTTGGCCTGAATCCTCGAGGATTCAGGCCAAGGTATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178373.3-410s21c1
Sequence:CCGGCCCATCAGAACAGCGCAAGAACTCGAGTTCTTGCGCTGTTCTGATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412395    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178373.3-1123s21c1
Sequence:CCGGCTCATCATGCAGTAGACATTACTCGAGTAATGTCTACTGCATGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178373.3-1002s21c1
Sequence:CCGGGCTTAGAGGACTAACACTTAGCTCGAGCTAAGTGTTAGTCCTCTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks