EMAIL THIS PAGE TO A FRIEND

CIITA

class II, major histocompatibility complex, transactivator

51 Gene Product Result for
Synonyms: C2TA CIITAIV MHC2TA NLRA
UniProtKB ID: P33076, D3DUG0
Gene ID:
Human(4261) Summary: This gene encodes a protein with an acidic transcriptional activation domain, 4 LRRs (leucine-rich repeats) and a GTP binding domain. The protein is located in the nucleus and acts as a positive regulator of class II major histocompatibility complex gene transcription, and is referred to as the 'master control factor' for the expression of these genes. The protein also binds GTP and uses GTP binding to facilitate its own transport into the nucleus. Once in the nucleus it does not bind DNA but rather uses an intrinsic acetyltransferase (AT) activity to act in a coactivator-like fashion. Mutations in this gene have been associated with bare lymphocyte syndrome type II (also known as hereditary MHC class II deficiency or HLA class II-deficient combined immunodeficiency), increased susceptibility to rheumatoid arthritis, multiple sclerosis, and possibly myocardial infarction. [provided by RefSeq, Jul 2008]
Mouse(12265) class II transactivator
Rat(85483) class II, major histocompatibility complex, transactivator
Zebrafish(100003537) class II, major histocompatibility complex, transactivator
dog(490008) class II, major histocompatibility complex, transactivator
cow(508720) class II, major histocompatibility complex, transactivator
Horse(100056546) class II, major histocompatibility complex, transactivator
chicken(427676) class II, major histocompatibility complex, transactivator
naked mole-rat(101721690) class II, major histocompatibility complex, transactivator
domestic guinea pig(100726338) class II, major histocompatibility complex, transactivator
sheep(101106564) class II, major histocompatibility complex, transactivator
Domestic Rabbit(100338894) class II, major histocompatibility complex, transactivator
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2107936 Anti-C2TA antibody produced in rabbit affinity isolated antibody rat, canine, human, mouse
western blot pricing
AV36830 Anti-C2TA antibody produced in rabbit affinity isolated antibody, lyophilized powder canine, rat, mouse
western blot pricing
SAB2100431 Anti-CIITA antibody produced in rabbit affinity isolated antibody guinea pig, pig, canine, rabbit, mouse, rat, horse, human
western blot pricing
SAB4501876 Anti-CIITA antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB3500991 Anti-CIITA antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
C3367 Anti-CIITA antibody, Mouse monoclonal clone 7-1H, purified from hybridoma cell culture mouse, human
immunocytochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000246 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000246 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000246 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007575 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007575 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007575 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU150591 MISSION® esiRNA esiRNA human CIITA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000246 Rosetta Predictions human pricing
NM_053529 Rosetta Predictions rat pricing
NM_007575 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000246 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081679 predicted 2924
2 SASI_Hs01_00081680 predicted 3576
3 SASI_Hs01_00081682 predicted 494
4 SASI_Hs01_00081683 predicted 339
5 SASI_Hs01_00081684 predicted 846
6 SASI_Hs01_00081685 predicted 2355
7 SASI_Hs02_00302162 predicted 485
8 SASI_Hs01_00081686 predicted 524
9 SASI_Hs01_00081687 predicted 2134
10 SASI_Hs01_00081688 predicted 358
11 SASI_Hs01_00081681 predicted 2849
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109545 predicted 1872
2 SASI_Rn01_00109546 predicted 2316
3 SASI_Rn01_00109547 predicted 2417
4 SASI_Rn01_00109548 predicted 1477
5 SASI_Rn01_00109549 predicted 1587
6 SASI_Rn01_00109550 predicted 2510
7 SASI_Rn01_00109551 predicted 2601
8 SASI_Rn01_00109553 predicted 511
9 SASI_Rn01_00109554 predicted 3282
10 SASI_Rn02_00266148 predicted 773
11 SASI_Rn01_00109552 predicted 3024
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007575 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171824 predicted 302
2 SASI_Mm02_00311960 predicted 1830
3 SASI_Mm01_00171825 predicted 2927
4 SASI_Mm01_00171826 predicted 2292
5 SASI_Mm01_00171827 predicted 1849
6 SASI_Mm01_00171828 predicted 2195
7 SASI_Mm02_00311961 predicted 3320
8 SASI_Mm01_00171829 predicted 1128
9 SASI_Mm01_00171830 predicted 556
10 SASI_Mm01_00171831 predicted 3067
11 SASI_Mm01_00171832 predicted 2866
12 SASI_Mm01_00171833 predicted 2710
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000246
VALIDATED
CIITA MISSION shRNA Bacterial Glycerol Stock
class II, major histocompatibility complex, transactivator
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000246.3-230s21c1
Sequence:CCGGGGCTACCTGGAGCTTCTTAACCTCGAGGTTAAGAAGCTCCAGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000246.3-4428s21c1
Sequence:CCGGACAGCTAATGGGACACTAATGCTCGAGCATTAGTGTCCCATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000246.3-3273s21c1
Sequence:GTACCGGTCAGGCTAAGCTTGTACAATACTCGAGTATTGTACAAGCTTAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000246.3-1860s21c1
Sequence:CCGGCATACGTGATGCGCTACTTTGCTCGAGCAAAGTAGCGCATCACGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_000246.3-468s21c1
Sequence:CCGGAGGGCCTGAGCAAGGACATTTCTCGAGAAATGTCCTTGCTCAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000246.1-6080s1c1
Sequence:CCGGGCCTCGAGTTATTAACACTAACTCGAGTTAGTGTTAATAACTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000246.1-2143s1c1
Sequence:CCGGCGCAGACATCAAAGTACCCTACTCGAGTAGGGTACTTTGATGTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000246.1-418s1c1
Sequence:CCGGGCTTATGCCAATATCGCGGAACTCGAGTTCCGCGATATTGGCATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000246.1-3276s1c1
Sequence:CCGGGCTCAGGCTAAGCTTGTACAACTCGAGTTGTACAAGCTTAGCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000246.1-1864s1c1
Sequence:CCGGGCATACGTGATGCGCTACTTTCTCGAGAAAGTAGCGCATCACGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000246
VALIDATED
CIITA MISSION shRNA shRNA Plasmid DNA
class II, major histocompatibility complex, transactivator
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000246.3-230s21c1
Sequence:CCGGGGCTACCTGGAGCTTCTTAACCTCGAGGTTAAGAAGCTCCAGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000246.3-4428s21c1
Sequence:CCGGACAGCTAATGGGACACTAATGCTCGAGCATTAGTGTCCCATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000246.3-3273s21c1
Sequence:GTACCGGTCAGGCTAAGCTTGTACAATACTCGAGTATTGTACAAGCTTAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000246.3-1860s21c1
Sequence:CCGGCATACGTGATGCGCTACTTTGCTCGAGCAAAGTAGCGCATCACGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_000246.3-468s21c1
Sequence:CCGGAGGGCCTGAGCAAGGACATTTCTCGAGAAATGTCCTTGCTCAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000246.1-6080s1c1
Sequence:CCGGGCCTCGAGTTATTAACACTAACTCGAGTTAGTGTTAATAACTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000246.1-2143s1c1
Sequence:CCGGCGCAGACATCAAAGTACCCTACTCGAGTAGGGTACTTTGATGTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000246.1-418s1c1
Sequence:CCGGGCTTATGCCAATATCGCGGAACTCGAGTTCCGCGATATTGGCATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000246.1-3276s1c1
Sequence:CCGGGCTCAGGCTAAGCTTGTACAACTCGAGTTGTACAAGCTTAGCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000246.1-1864s1c1
Sequence:CCGGGCATACGTGATGCGCTACTTTCTCGAGAAAGTAGCGCATCACGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000246
VALIDATED
CIITA MISSION shRNA Lentiviral Transduction Particles
class II, major histocompatibility complex, transactivator
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_000246.3-230s21c1
Sequence:CCGGGGCTACCTGGAGCTTCTTAACCTCGAGGTTAAGAAGCTCCAGGTAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230867    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000246.3-4428s21c1
Sequence:CCGGACAGCTAATGGGACACTAATGCTCGAGCATTAGTGTCCCATTAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000246.3-3273s21c1
Sequence:GTACCGGTCAGGCTAAGCTTGTACAATACTCGAGTATTGTACAAGCTTAGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000246.3-1860s21c1
Sequence:CCGGCATACGTGATGCGCTACTTTGCTCGAGCAAAGTAGCGCATCACGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_000246.3-468s21c1
Sequence:CCGGAGGGCCTGAGCAAGGACATTTCTCGAGAAATGTCCTTGCTCAGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019069    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_000246.1-6080s1c1
Sequence:CCGGGCCTCGAGTTATTAACACTAACTCGAGTTAGTGTTAATAACTCGAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019071    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_000246.1-2143s1c1
Sequence:CCGGCGCAGACATCAAAGTACCCTACTCGAGTAGGGTACTTTGATGTCTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000246.1-418s1c1
Sequence:CCGGGCTTATGCCAATATCGCGGAACTCGAGTTCCGCGATATTGGCATAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_000246.1-3276s1c1
Sequence:CCGGGCTCAGGCTAAGCTTGTACAACTCGAGTTGTACAAGCTTAGCCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019070    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000246.1-1864s1c1
Sequence:CCGGGCATACGTGATGCGCTACTTTCTCGAGAAAGTAGCGCATCACGTATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007575
CIITA MISSION shRNA Bacterial Glycerol Stock
class II, major histocompatibility complex, transactivator
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007575.1-4149s1c1
Sequence:CCGGGCCGAACTATAATAACTTGAACTCGAGTTCAAGTTATTATAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-1263s1c1
Sequence:CCGGGCTACAATATGACTTTGTCTTCTCGAGAAGACAAAGTCATATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-2668s1c1
Sequence:CCGGGCAGAGGAGAAGTTCACCATTCTCGAGAATGGTGAACTTCTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-1829s1c1
Sequence:CCGGCCCAGCTACCTTGTACACTTACTCGAGTAAGTGTACAAGGTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-1659s1c1
Sequence:CCGGCAAGACTTACATGAGGCACTACTCGAGTAGTGCCTCATGTAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007575
CIITA MISSION shRNA shRNA Plasmid DNA
class II, major histocompatibility complex, transactivator
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007575.1-4149s1c1
Sequence:CCGGGCCGAACTATAATAACTTGAACTCGAGTTCAAGTTATTATAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-1263s1c1
Sequence:CCGGGCTACAATATGACTTTGTCTTCTCGAGAAGACAAAGTCATATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-2668s1c1
Sequence:CCGGGCAGAGGAGAAGTTCACCATTCTCGAGAATGGTGAACTTCTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-1829s1c1
Sequence:CCGGCCCAGCTACCTTGTACACTTACTCGAGTAAGTGTACAAGGTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-1659s1c1
Sequence:CCGGCAAGACTTACATGAGGCACTACTCGAGTAGTGCCTCATGTAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007575
CIITA MISSION shRNA Lentiviral Transduction Particles
class II, major histocompatibility complex, transactivator
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086448    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007575.1-4149s1c1
Sequence:CCGGGCCGAACTATAATAACTTGAACTCGAGTTCAAGTTATTATAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086449    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-1263s1c1
Sequence:CCGGGCTACAATATGACTTTGTCTTCTCGAGAAGACAAAGTCATATTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086450    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-2668s1c1
Sequence:CCGGGCAGAGGAGAAGTTCACCATTCTCGAGAATGGTGAACTTCTCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-1829s1c1
Sequence:CCGGCCCAGCTACCTTGTACACTTACTCGAGTAAGTGTACAAGGTAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007575.1-1659s1c1
Sequence:CCGGCAAGACTTACATGAGGCACTACTCGAGTAGTGCCTCATGTAAGTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks