EMAIL THIS PAGE TO A FRIEND

CILP

cartilage intermediate layer protein, nucleotide pyrophosphohydrolase

126 Gene Product Result for
Synonyms: CILP-1 HsT18872
UniProtKB ID: O75339, B2R8F7, Q6UW99, Q8IYI5
Gene ID:
Human(8483) Summary: Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]
Mouse(214425) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Rat(315761) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Zebrafish(553329) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Horse(100053337) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
cow(100336614) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
domestic cat(101084795) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
chicken(415533) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
dog(487603) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
sheep(101119218) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
domestic guinea pig(100721580) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
naked mole-rat(101723750) cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1370 Human CILP-1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_173385 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173385 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173385 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003613 Rosetta Predictions human pricing
NM_001108161 Rosetta Predictions rat pricing
NM_173385 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088804 predicted 971
2 SASI_Hs01_00088805 predicted 1324
3 SASI_Hs01_00088806 predicted 2998
4 SASI_Hs01_00088807 predicted 2161
5 SASI_Hs02_00335950 predicted 2139
6 SASI_Hs01_00088809 predicted 2176
7 SASI_Hs01_00088810 predicted 3041
8 SASI_Hs01_00088811 predicted 1073
9 SASI_Hs01_00088812 predicted 2530
10 SASI_Hs02_00335951 predicted 2495
11 SASI_Hs01_00088808 predicted 2222
12 SASI_Hs01_00088813 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108161 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235954 predicted 886
2 SASI_Rn02_00235955 predicted 203
3 SASI_Rn02_00235956 predicted 1041
4 SASI_Rn02_00235957 predicted 3354
5 SASI_Rn02_00235958 predicted 2941
6 SASI_Rn02_00235959 predicted 2131
7 SASI_Rn02_00235960 predicted 2056
8 SASI_Rn02_00235961 predicted 3197
9 SASI_Rn02_00235962 predicted 1152
10 SASI_Rn02_00235963 predicted 2222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173385 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158081 predicted 3030
2 SASI_Mm02_00345205 predicted 3723
3 SASI_Mm01_00158082 predicted 2346
4 SASI_Mm01_00158083 predicted 3857
5 SASI_Mm01_00158084 predicted 548
6 SASI_Mm02_00345206 predicted 2619
7 SASI_Mm01_00158085 predicted 334
8 SASI_Mm01_00158086 predicted 3160
9 SASI_Mm01_00158087 predicted 2255
10 SASI_Mm01_00158088 predicted 1436
11 SASI_Mm01_00158079 predicted 3228
12 SASI_Mm01_00158080 predicted 3387
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003613
CILP MISSION shRNA Bacterial Glycerol Stock
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-1390s1c1
Sequence:CCGGGCCACCAACTCCTTCTACTATCTCGAGATAGTAGAAGGAGTTGGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-954s1c1
Sequence:CCGGGAAGATCACAAAGGTCAAGTTCTCGAGAACTTGACCTTTGTGATCTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003613.x-3786s1c1
Sequence:CCGGCGTGAATTTGCTTGTTTGTTTCTCGAGAAACAAACAAGCAAATTCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-2682s1c1
Sequence:CCGGGCCCTATCTCAACAAGCTCAACTCGAGTTGAGCTTGTTGAGATAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-2456s1c1
Sequence:CCGGCCGTGATTAACCTGGAGCCTACTCGAGTAGGCTCCAGGTTAATCACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-2686s21c1
Sequence:CCGGAGTGGAGTCTTCTCCTAAATTCTCGAGAATTTAGGAGAAGACTCCACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-2183s21c1
Sequence:CCGGGTCACCTCAGAGCCACTTAATCTCGAGATTAAGTGGCTCTGAGGTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-405s21c1
Sequence:CCGGACGCCATTCGCTTCTACTATGCTCGAGCATAGTAGAAGCGAATGGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-2771s21c1
Sequence:CCGGCATGAGGATCCACGGGTTAAACTCGAGTTTAACCCGTGGATCCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-1393s21c1
Sequence:CCGGAGTTCCTGAGAGCTATCTTATCTCGAGATAAGATAGCTCTCAGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-1186s21c1
Sequence:CCGGGCCCAGGCCAGACAAGTATTTCTCGAGAAATACTTGTCTGGCCTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003613.3-3801s21c1
Sequence:CCGGCAAACTGTCACTTGGTTAATTCTCGAGAATTAACCAAGTGACAGTTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003613
CILP MISSION shRNA shRNA Plasmid DNA
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-1390s1c1
Sequence:CCGGGCCACCAACTCCTTCTACTATCTCGAGATAGTAGAAGGAGTTGGTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-954s1c1
Sequence:CCGGGAAGATCACAAAGGTCAAGTTCTCGAGAACTTGACCTTTGTGATCTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003613.x-3786s1c1
Sequence:CCGGCGTGAATTTGCTTGTTTGTTTCTCGAGAAACAAACAAGCAAATTCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-2682s1c1
Sequence:CCGGGCCCTATCTCAACAAGCTCAACTCGAGTTGAGCTTGTTGAGATAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-2456s1c1
Sequence:CCGGCCGTGATTAACCTGGAGCCTACTCGAGTAGGCTCCAGGTTAATCACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000422163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-2686s21c1
Sequence:CCGGAGTGGAGTCTTCTCCTAAATTCTCGAGAATTTAGGAGAAGACTCCACTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-2183s21c1
Sequence:CCGGGTCACCTCAGAGCCACTTAATCTCGAGATTAAGTGGCTCTGAGGTGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000378030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-405s21c1
Sequence:CCGGACGCCATTCGCTTCTACTATGCTCGAGCATAGTAGAAGCGAATGGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-2771s21c1
Sequence:CCGGCATGAGGATCCACGGGTTAAACTCGAGTTTAACCCGTGGATCCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-1393s21c1
Sequence:CCGGAGTTCCTGAGAGCTATCTTATCTCGAGATAAGATAGCTCTCAGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-1186s21c1
Sequence:CCGGGCCCAGGCCAGACAAGTATTTCTCGAGAAATACTTGTCTGGCCTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003613.3-3801s21c1
Sequence:CCGGCAAACTGTCACTTGGTTAATTCTCGAGAATTAACCAAGTGACAGTTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003613
CILP MISSION shRNA Lentiviral Transduction Particles
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-1390s1c1
Sequence:CCGGGCCACCAACTCCTTCTACTATCTCGAGATAGTAGAAGGAGTTGGTGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-954s1c1
Sequence:CCGGGAAGATCACAAAGGTCAAGTTCTCGAGAACTTGACCTTTGTGATCTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002936    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003613.x-3786s1c1
Sequence:CCGGCGTGAATTTGCTTGTTTGTTTCTCGAGAAACAAACAAGCAAATTCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-2682s1c1
Sequence:CCGGGCCCTATCTCAACAAGCTCAACTCGAGTTGAGCTTGTTGAGATAGGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003613.x-2456s1c1
Sequence:CCGGCCGTGATTAACCTGGAGCCTACTCGAGTAGGCTCCAGGTTAATCACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000422163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-2686s21c1
Sequence:CCGGAGTGGAGTCTTCTCCTAAATTCTCGAGAATTTAGGAGAAGACTCCACTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-2183s21c1
Sequence:CCGGGTCACCTCAGAGCCACTTAATCTCGAGATTAAGTGGCTCTGAGGTGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000378030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-405s21c1
Sequence:CCGGACGCCATTCGCTTCTACTATGCTCGAGCATAGTAGAAGCGAATGGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-2771s21c1
Sequence:CCGGCATGAGGATCCACGGGTTAAACTCGAGTTTAACCCGTGGATCCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-1393s21c1
Sequence:CCGGAGTTCCTGAGAGCTATCTTATCTCGAGATAAGATAGCTCTCAGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003613.3-1186s21c1
Sequence:CCGGGCCCAGGCCAGACAAGTATTTCTCGAGAAATACTTGTCTGGCCTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003613.3-3801s21c1
Sequence:CCGGCAAACTGTCACTTGGTTAATTCTCGAGAATTAACCAAGTGACAGTTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173385
CILP MISSION shRNA Bacterial Glycerol Stock
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173385.1-3996s1c1
Sequence:CCGGGCCAGCCTTTACACTAATGATCTCGAGATCATTAGTGTAAAGGCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173385.1-553s1c1
Sequence:CCGGGCCAGAACTGTTCCAATTATACTCGAGTATAATTGGAACAGTTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-1220s21c1
Sequence:CCGGCTGGATCCCTCCCTCTATAAGCTCGAGCTTATAGAGGGAGGGATCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-2762s21c1
Sequence:CCGGCATGAGGATCCACGGGTTAAACTCGAGTTTAACCCGTGGATCCTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-1062s21c1
Sequence:CCGGCTACCATCAATGCGGAGTTTGCTCGAGCAAACTCCGCATTGATGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173385.2-3995s21c1
Sequence:CCGGGCCAGCCTTTACACTAATGATCTCGAGATCATTAGTGTAAAGGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-3336s21c1
Sequence:CCGGACAATGACACCAGCGAGTATACTCGAGTATACTCGCTGGTGTCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173385
CILP MISSION shRNA shRNA Plasmid DNA
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173385.1-3996s1c1
Sequence:CCGGGCCAGCCTTTACACTAATGATCTCGAGATCATTAGTGTAAAGGCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000191525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173385.1-553s1c1
Sequence:CCGGGCCAGAACTGTTCCAATTATACTCGAGTATAATTGGAACAGTTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-1220s21c1
Sequence:CCGGCTGGATCCCTCCCTCTATAAGCTCGAGCTTATAGAGGGAGGGATCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-2762s21c1
Sequence:CCGGCATGAGGATCCACGGGTTAAACTCGAGTTTAACCCGTGGATCCTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-1062s21c1
Sequence:CCGGCTACCATCAATGCGGAGTTTGCTCGAGCAAACTCCGCATTGATGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000248562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173385.2-3995s21c1
Sequence:CCGGGCCAGCCTTTACACTAATGATCTCGAGATCATTAGTGTAAAGGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-3336s21c1
Sequence:CCGGACAATGACACCAGCGAGTATACTCGAGTATACTCGCTGGTGTCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173385
CILP MISSION shRNA Lentiviral Transduction Particles
cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201332    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173385.1-3996s1c1
Sequence:CCGGGCCAGCCTTTACACTAATGATCTCGAGATCATTAGTGTAAAGGCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000191525    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_173385.1-553s1c1
Sequence:CCGGGCCAGAACTGTTCCAATTATACTCGAGTATAATTGGAACAGTTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-1220s21c1
Sequence:CCGGCTGGATCCCTCCCTCTATAAGCTCGAGCTTATAGAGGGAGGGATCCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-2762s21c1
Sequence:CCGGCATGAGGATCCACGGGTTAAACTCGAGTTTAACCCGTGGATCCTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248563    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-1062s21c1
Sequence:CCGGCTACCATCAATGCGGAGTTTGCTCGAGCAAACTCCGCATTGATGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000248562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_173385.2-3995s21c1
Sequence:CCGGGCCAGCCTTTACACTAATGATCTCGAGATCATTAGTGTAAAGGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173385.2-3336s21c1
Sequence:CCGGACAATGACACCAGCGAGTATACTCGAGTATACTCGCTGGTGTCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)