EMAIL THIS PAGE TO A FRIEND

CINP

cyclin-dependent kinase 2 interacting protein

48 Gene Product Result for
UniProtKB ID: Q9BW66, F5H7P3, F5H8A7, Q9NPF9
Gene ID:
Human(51550) Summary: The protein encoded by this gene interacts with CDK2, MCM5, and CDC7, and is associated with the origin recognition complex protein ORC2. It acts as a homodimer and is involved in replication and ATR-mediated checkpoint signaling. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
Mouse(67236) cyclin-dependent kinase 2 interacting protein
Rat(299334) cyclin-dependent kinase 2-interacting protein
Zebrafish(552991) cyclin-dependent kinase 2 interacting protein
chicken(423467) cyclin-dependent kinase 2 interacting protein
dog(612609) cyclin-dependent kinase 2 interacting protein
domestic cat(101083600) cyclin-dependent kinase 2 interacting protein
cow(613767) cyclin-dependent kinase 2 interacting protein
naked mole-rat(101720127) cyclin-dependent kinase 2 interacting protein
domestic guinea pig(100720578) cyclin-dependent kinase 2 interacting protein
sheep(101103845) cyclin-dependent kinase 2 interacting protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026048 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026048 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026048 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032630 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032630 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032630 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032630 Rosetta Predictions human pricing
NM_001106758 Rosetta Predictions rat pricing
NM_026048 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032630 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090816 predicted 412
2 SASI_Hs01_00090817 predicted 477
3 SASI_Hs01_00090818 predicted 504
4 SASI_Hs01_00090820 predicted 325
5 SASI_Hs01_00090821 predicted 353
6 SASI_Hs01_00090822 predicted 198
7 SASI_Hs02_00360181 predicted 482
8 SASI_Hs02_00360182 predicted 348
9 SASI_Hs02_00360183 predicted 509
10 SASI_Hs01_00090823 predicted 399
11 SASI_Hs01_00090819 predicted 403
12 SASI_Hs01_00090824 predicted 739
13 SASI_Hs01_00090825 predicted 607
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106758 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222108 predicted 275
2 SASI_Rn02_00222109 predicted 896
3 SASI_Rn02_00222110 predicted 1039
4 SASI_Rn02_00222111 predicted 1054
5 SASI_Rn02_00222112 predicted 954
6 SASI_Rn02_00222113 predicted 1094
7 SASI_Rn02_00222114 predicted 1141
8 SASI_Rn02_00222115 predicted 941
9 SASI_Rn02_00222116 predicted 787
10 SASI_Rn02_00222117 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026048 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172699 predicted 553
2 SASI_Mm02_00329556 predicted 490
3 SASI_Mm01_00172700 predicted 329
4 SASI_Mm01_00172701 predicted 390
5 SASI_Mm01_00172702 predicted 194
6 SASI_Mm01_00172703 predicted 722
7 SASI_Mm01_00172704 predicted 376
8 SASI_Mm01_00172705 predicted 270
9 SASI_Mm01_00172706 predicted 549
10 SASI_Mm01_00172707 predicted 289
11 SASI_Mm01_00172708 predicted 727
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026048
CINP MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 2 interacting protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-122s1c1
Sequence:CCGGGCTGCTGACTGGCATAACTTACTCGAGTAAGTTATGCCAGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-496s1c1
Sequence:CCGGGCTCTCTGAAGCATACAAGAACTCGAGTTCTTGTATGCTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-393s1c1
Sequence:CCGGAGGGAATTTGTGAGCTAGAAACTCGAGTTTCTAGCTCACAAATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026048.2-1094s1c1
Sequence:CCGGCCCAGGATTATTAGATGTTAACTCGAGTTAACATCTAATAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-257s1c1
Sequence:CCGGGCTTCCATGGAAGAGGAAGAACTCGAGTTCTTCCTCTTCCATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-495s21c1
Sequence:CCGGGCTCTCTGAAGCATACAAGAACTCGAGTTCTTGTATGCTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-392s21c1
Sequence:CCGGAGGGAATTTGTGAGCTAGAAACTCGAGTTTCTAGCTCACAAATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026048.3-1093s21c1
Sequence:CCGGCCCAGGATTATTAGATGTTAACTCGAGTTAACATCTAATAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-256s21c1
Sequence:CCGGGCTTCCATGGAAGAGGAAGAACTCGAGTTCTTCCTCTTCCATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-121s21c1
Sequence:CCGGGCTGCTGACTGGCATAACTTACTCGAGTAAGTTATGCCAGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026048
CINP MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 2 interacting protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-122s1c1
Sequence:CCGGGCTGCTGACTGGCATAACTTACTCGAGTAAGTTATGCCAGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-496s1c1
Sequence:CCGGGCTCTCTGAAGCATACAAGAACTCGAGTTCTTGTATGCTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-393s1c1
Sequence:CCGGAGGGAATTTGTGAGCTAGAAACTCGAGTTTCTAGCTCACAAATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026048.2-1094s1c1
Sequence:CCGGCCCAGGATTATTAGATGTTAACTCGAGTTAACATCTAATAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-257s1c1
Sequence:CCGGGCTTCCATGGAAGAGGAAGAACTCGAGTTCTTCCTCTTCCATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-495s21c1
Sequence:CCGGGCTCTCTGAAGCATACAAGAACTCGAGTTCTTGTATGCTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-392s21c1
Sequence:CCGGAGGGAATTTGTGAGCTAGAAACTCGAGTTTCTAGCTCACAAATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026048.3-1093s21c1
Sequence:CCGGCCCAGGATTATTAGATGTTAACTCGAGTTAACATCTAATAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-256s21c1
Sequence:CCGGGCTTCCATGGAAGAGGAAGAACTCGAGTTCTTCCTCTTCCATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-121s21c1
Sequence:CCGGGCTGCTGACTGGCATAACTTACTCGAGTAAGTTATGCCAGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026048
CINP MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 2 interacting protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-122s1c1
Sequence:CCGGGCTGCTGACTGGCATAACTTACTCGAGTAAGTTATGCCAGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-496s1c1
Sequence:CCGGGCTCTCTGAAGCATACAAGAACTCGAGTTCTTGTATGCTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-393s1c1
Sequence:CCGGAGGGAATTTGTGAGCTAGAAACTCGAGTTTCTAGCTCACAAATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026048.2-1094s1c1
Sequence:CCGGCCCAGGATTATTAGATGTTAACTCGAGTTAACATCTAATAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026048.2-257s1c1
Sequence:CCGGGCTTCCATGGAAGAGGAAGAACTCGAGTTCTTCCTCTTCCATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-495s21c1
Sequence:CCGGGCTCTCTGAAGCATACAAGAACTCGAGTTCTTGTATGCTTCAGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-392s21c1
Sequence:CCGGAGGGAATTTGTGAGCTAGAAACTCGAGTTTCTAGCTCACAAATTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308798    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026048.3-1093s21c1
Sequence:CCGGCCCAGGATTATTAGATGTTAACTCGAGTTAACATCTAATAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-256s21c1
Sequence:CCGGGCTTCCATGGAAGAGGAAGAACTCGAGTTCTTCCTCTTCCATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026048.3-121s21c1
Sequence:CCGGGCTGCTGACTGGCATAACTTACTCGAGTAAGTTATGCCAGTCAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032630
VALIDATED
CINP MISSION shRNA Bacterial Glycerol Stock
cyclin-dependent kinase 2 interacting protein
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032630.2-144s1c1
Sequence:CCGGGCGGCTGATTGGCACAATTTACTCGAGTAAATTGTGCCAATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032630.2-495s1c1
Sequence:CCGGCATTTCTATGAGGTTTCGCATCTCGAGATGCGAAACCTCATAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032630.2-306s1c1
Sequence:CCGGTGTCTGGAATATAACGAGGAACTCGAGTTCCTCGTTATATTCCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032630.2-203s1c1
Sequence:CCGGCACTGCAAATAATATTGCCAACTCGAGTTGGCAATATTATTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032630.2-110s1c1
Sequence:CCGGCTTATCTGTCAGTGCAAGAAACTCGAGTTTCTTGCACTGACAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032630.2-495s21c1
Sequence:CCGGCATTTCTATGAGGTTTCGCATCTCGAGATGCGAAACCTCATAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032630.2-404s21c1
Sequence:CCGGTTCAACTACCAAGGGAATTTGCTCGAGCAAATTCCCTTGGTAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032630.2-144s21c1
Sequence:CCGGGCGGCTGATTGGCACAATTTACTCGAGTAAATTGTGCCAATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032630.2-110s21c1
Sequence:CCGGCTTATCTGTCAGTGCAAGAAACTCGAGTTTCTTGCACTGACAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032630.2-816s21c1
Sequence:CCGGTCTTCTGGCCAGAGCTTGTCACTCGAGTGACAAGCTCTGGCCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032630
VALIDATED
CINP MISSION shRNA shRNA Plasmid DNA
cyclin-dependent kinase 2 interacting protein
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032630.2-144s1c1
Sequence:CCGGGCGGCTGATTGGCACAATTTACTCGAGTAAATTGTGCCAATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032630.2-495s1c1
Sequence:CCGGCATTTCTATGAGGTTTCGCATCTCGAGATGCGAAACCTCATAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032630.2-306s1c1
Sequence:CCGGTGTCTGGAATATAACGAGGAACTCGAGTTCCTCGTTATATTCCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032630.2-203s1c1
Sequence:CCGGCACTGCAAATAATATTGCCAACTCGAGTTGGCAATATTATTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032630.2-110s1c1
Sequence:CCGGCTTATCTGTCAGTGCAAGAAACTCGAGTTTCTTGCACTGACAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032630.2-495s21c1
Sequence:CCGGCATTTCTATGAGGTTTCGCATCTCGAGATGCGAAACCTCATAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032630.2-404s21c1
Sequence:CCGGTTCAACTACCAAGGGAATTTGCTCGAGCAAATTCCCTTGGTAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032630.2-144s21c1
Sequence:CCGGGCGGCTGATTGGCACAATTTACTCGAGTAAATTGTGCCAATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032630.2-110s21c1
Sequence:CCGGCTTATCTGTCAGTGCAAGAAACTCGAGTTTCTTGCACTGACAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032630.2-816s21c1
Sequence:CCGGTCTTCTGGCCAGAGCTTGTCACTCGAGTGACAAGCTCTGGCCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032630
VALIDATED
CINP MISSION shRNA Lentiviral Transduction Particles
cyclin-dependent kinase 2 interacting protein
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_032630.2-144s1c1
Sequence:CCGGGCGGCTGATTGGCACAATTTACTCGAGTAAATTGTGCCAATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_032630.2-495s1c1
Sequence:CCGGCATTTCTATGAGGTTTCGCATCTCGAGATGCGAAACCTCATAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032630.2-306s1c1
Sequence:CCGGTGTCTGGAATATAACGAGGAACTCGAGTTCCTCGTTATATTCCAGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032630.2-203s1c1
Sequence:CCGGCACTGCAAATAATATTGCCAACTCGAGTTGGCAATATTATTTGCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_032630.2-110s1c1
Sequence:CCGGCTTATCTGTCAGTGCAAGAAACTCGAGTTTCTTGCACTGACAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310466    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032630.2-495s21c1
Sequence:CCGGCATTTCTATGAGGTTTCGCATCTCGAGATGCGAAACCTCATAGAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303751    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032630.2-404s21c1
Sequence:CCGGTTCAACTACCAAGGGAATTTGCTCGAGCAAATTCCCTTGGTAGTTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_032630.2-144s21c1
Sequence:CCGGGCGGCTGATTGGCACAATTTACTCGAGTAAATTGTGCCAATCAGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032630.2-110s21c1
Sequence:CCGGCTTATCTGTCAGTGCAAGAAACTCGAGTTTCTTGCACTGACAGATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_032630.2-816s21c1
Sequence:CCGGTCTTCTGGCCAGAGCTTGTCACTCGAGTGACAAGCTCTGGCCAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks