EMAIL THIS PAGE TO A FRIEND

CIR1

corepressor interacting with RBPJ, 1

Synonyms: CIR
Gene ID:
Mouse(66935) corepressor interacting with RBPJ, 1
Rat(362149) corepressor interacting with RBPJ, 1
chicken(426529) corepressor interacting with RBPJ, 1
domestic cat(101095430) corepressor interacting with RBPJ, 1
cow(534057) corepressor interacting with RBPJ, 1
dog(478804) corepressor interacting with RBPJ, 1
naked mole-rat(101713751) corepressor interacting with RBPJ, 1
domestic guinea pig(100727165) corepressor interacting with RBPJ, 1
sheep(101105893) corepressor interacting with RBPJ, 1
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004882 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004882 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004882 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004882 Rosetta Predictions human pricing
NM_001007799 Rosetta Predictions rat pricing
NM_025854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004882 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039015 predicted 1315
2 SASI_Hs01_00039016 predicted 1261
3 SASI_Hs01_00039017 predicted 1418
4 SASI_Hs01_00039018 predicted 1411
5 SASI_Hs01_00039019 predicted 1260
6 SASI_Hs01_00039020 predicted 1350
7 SASI_Hs01_00039021 predicted 1539
8 SASI_Hs01_00039022 predicted 1363
9 SASI_Hs01_00039024 predicted 1404
10 SASI_Hs02_00338513 predicted 1449
11 SASI_Hs01_00039023 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007799 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117235 predicted 32
2 SASI_Rn01_00117236 predicted 975
3 SASI_Rn01_00117237 predicted 960
4 SASI_Rn01_00117238 predicted 348
5 SASI_Rn01_00117239 predicted 518
6 SASI_Rn01_00117240 predicted 151
7 SASI_Rn01_00117241 predicted 290
8 SASI_Rn02_00198959 predicted 179
9 SASI_Rn01_00117242 predicted 341
10 SASI_Rn01_00117243 predicted 321
11 SASI_Rn01_00117244 predicted 73
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076824 predicted 296
2 SASI_Mm01_00076825 predicted 450
3 SASI_Mm01_00076826 predicted 282
4 SASI_Mm01_00076827 predicted 444
5 SASI_Mm01_00076828 predicted 366
6 SASI_Mm02_00329136 predicted 277
7 SASI_Mm01_00076821 predicted 1240
8 SASI_Mm01_00076830 predicted 366
9 SASI_Mm02_00329137 predicted 469
10 SASI_Mm02_00329138 predicted 467
11 SASI_Mm01_00076822 predicted 1313
12 SASI_Mm01_00076823 predicted 1161
13 SASI_Mm01_00076829 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025854
VALIDATED
CIR1 MISSION shRNA Bacterial Glycerol Stock
corepressor interacting with RBPJ, 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025854.3-1636s21c1
Sequence:CCGGAGCTTAAGTTTGCAGATATTTCTCGAGAAATATCTGCAAACTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025854.3-228s21c1
Sequence:CCGGTTAATGCAACAGTACCTTAAACTCGAGTTTAAGGTACTGTTGCATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025854.3-291s21c1
Sequence:CCGGCGTGTGAAGAATGGCCTGAATCTCGAGATTCAGGCCATTCTTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025854.3-725s21c1
Sequence:CCGGCCCTGAAGTTGAGTTCTTAAACTCGAGTTTAAGAACTCAACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025854.3-471s21c1
Sequence:CCGGGTTCGAAATGTAAGGTGTATTCTCGAGAATACACCTTACATTTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025854.1-1559s1c1
Sequence:CCGGGCAGATATTTGCAGGGAATTTCTCGAGAAATTCCCTGCAAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025854.1-998s1c1
Sequence:CCGGCCTAAGAACATGCTTTACGAACTCGAGTTCGTAAAGCATGTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025854.1-171s1c1
Sequence:CCGGCGTATGATAACAGATTGCTTACTCGAGTAAGCAATCTGTTATCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025854.1-637s1c1
Sequence:CCGGCCCTGAAGTTGAGTTCTTAAACTCGAGTTTAAGAACTCAACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025854.1-203s1c1
Sequence:CCGGCGTGTGAAGAATGGCCTGAATCTCGAGATTCAGGCCATTCTTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025854
VALIDATED
CIR1 MISSION shRNA shRNA Plasmid DNA
corepressor interacting with RBPJ, 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025854.3-1636s21c1
Sequence:CCGGAGCTTAAGTTTGCAGATATTTCTCGAGAAATATCTGCAAACTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025854.3-228s21c1
Sequence:CCGGTTAATGCAACAGTACCTTAAACTCGAGTTTAAGGTACTGTTGCATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025854.3-291s21c1
Sequence:CCGGCGTGTGAAGAATGGCCTGAATCTCGAGATTCAGGCCATTCTTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025854.3-725s21c1
Sequence:CCGGCCCTGAAGTTGAGTTCTTAAACTCGAGTTTAAGAACTCAACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025854.3-471s21c1
Sequence:CCGGGTTCGAAATGTAAGGTGTATTCTCGAGAATACACCTTACATTTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025854.1-1559s1c1
Sequence:CCGGGCAGATATTTGCAGGGAATTTCTCGAGAAATTCCCTGCAAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025854.1-998s1c1
Sequence:CCGGCCTAAGAACATGCTTTACGAACTCGAGTTCGTAAAGCATGTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025854.1-171s1c1
Sequence:CCGGCGTATGATAACAGATTGCTTACTCGAGTAAGCAATCTGTTATCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025854.1-637s1c1
Sequence:CCGGCCCTGAAGTTGAGTTCTTAAACTCGAGTTTAAGAACTCAACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025854.1-203s1c1
Sequence:CCGGCGTGTGAAGAATGGCCTGAATCTCGAGATTCAGGCCATTCTTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025854
VALIDATED
CIR1 MISSION shRNA Lentiviral Transduction Particles
corepressor interacting with RBPJ, 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313208    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025854.3-1636s21c1
Sequence:CCGGAGCTTAAGTTTGCAGATATTTCTCGAGAAATATCTGCAAACTTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313209    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025854.3-228s21c1
Sequence:CCGGTTAATGCAACAGTACCTTAAACTCGAGTTTAAGGTACTGTTGCATTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025854.3-291s21c1
Sequence:CCGGCGTGTGAAGAATGGCCTGAATCTCGAGATTCAGGCCATTCTTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025854.3-725s21c1
Sequence:CCGGCCCTGAAGTTGAGTTCTTAAACTCGAGTTTAAGAACTCAACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025854.3-471s21c1
Sequence:CCGGGTTCGAAATGTAAGGTGTATTCTCGAGAATACACCTTACATTTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095254    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025854.1-1559s1c1
Sequence:CCGGGCAGATATTTGCAGGGAATTTCTCGAGAAATTCCCTGCAAATATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025854.1-998s1c1
Sequence:CCGGCCTAAGAACATGCTTTACGAACTCGAGTTCGTAAAGCATGTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025854.1-171s1c1
Sequence:CCGGCGTATGATAACAGATTGCTTACTCGAGTAAGCAATCTGTTATCATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025854.1-637s1c1
Sequence:CCGGCCCTGAAGTTGAGTTCTTAAACTCGAGTTTAAGAACTCAACTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025854.1-203s1c1
Sequence:CCGGCGTGTGAAGAATGGCCTGAATCTCGAGATTCAGGCCATTCTTCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004882
VALIDATED
CIR1 MISSION shRNA Bacterial Glycerol Stock
corepressor interacting with RBPJ, 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-1475s21c1
Sequence:CCGGTGACAATTACCTGGGAATAAACTCGAGTTTATTCCCAGGTAATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-625s21c1
Sequence:CCGGGGGTTTGCACTGAAACGAAATCTCGAGATTTCGTTTCAGTGCAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-449s21c1
Sequence:CCGGTTGGTATTCAGGTTCGAAATGCTCGAGCATTTCGAACCTGAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-267s21c1
Sequence:CCGGTATGGGAGATGAACGTGTAAACTCGAGTTTACACGTTCATCTCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-216s21c1
Sequence:CCGGATTGATGCAGCAATATCTTAACTCGAGTTAAGATATTGCTGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004882.3-1593s1c1
Sequence:CCGGGACTGTCAATTCAAGTACAAACTCGAGTTTGTACTTGAATTGACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004882.3-142s1c1
Sequence:CCGGGCCTCCAAATCCAATATCAAACTCGAGTTTGATATTGGATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004882.3-1407s1c1
Sequence:CCGGCCCAGGAGGTACACATACTAACTCGAGTTAGTATGTGTACCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004882.3-279s1c1
Sequence:CCGGACGTGTAAAGAATGGCCTTAACTCGAGTTAAGGCCATTCTTTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004882.3-280s1c1
Sequence:CCGGCGTGTAAAGAATGGCCTTAATCTCGAGATTAAGGCCATTCTTTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004882
VALIDATED
CIR1 MISSION shRNA shRNA Plasmid DNA
corepressor interacting with RBPJ, 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-1475s21c1
Sequence:CCGGTGACAATTACCTGGGAATAAACTCGAGTTTATTCCCAGGTAATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-625s21c1
Sequence:CCGGGGGTTTGCACTGAAACGAAATCTCGAGATTTCGTTTCAGTGCAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-449s21c1
Sequence:CCGGTTGGTATTCAGGTTCGAAATGCTCGAGCATTTCGAACCTGAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-267s21c1
Sequence:CCGGTATGGGAGATGAACGTGTAAACTCGAGTTTACACGTTCATCTCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-216s21c1
Sequence:CCGGATTGATGCAGCAATATCTTAACTCGAGTTAAGATATTGCTGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004882.3-1593s1c1
Sequence:CCGGGACTGTCAATTCAAGTACAAACTCGAGTTTGTACTTGAATTGACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004882.3-142s1c1
Sequence:CCGGGCCTCCAAATCCAATATCAAACTCGAGTTTGATATTGGATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004882.3-1407s1c1
Sequence:CCGGCCCAGGAGGTACACATACTAACTCGAGTTAGTATGTGTACCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004882.3-279s1c1
Sequence:CCGGACGTGTAAAGAATGGCCTTAACTCGAGTTAAGGCCATTCTTTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004882.3-280s1c1
Sequence:CCGGCGTGTAAAGAATGGCCTTAATCTCGAGATTAAGGCCATTCTTTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004882
VALIDATED
CIR1 MISSION shRNA Lentiviral Transduction Particles
corepressor interacting with RBPJ, 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232429    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-1475s21c1
Sequence:CCGGTGACAATTACCTGGGAATAAACTCGAGTTTATTCCCAGGTAATTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232428    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-625s21c1
Sequence:CCGGGGGTTTGCACTGAAACGAAATCTCGAGATTTCGTTTCAGTGCAAACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232427    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-449s21c1
Sequence:CCGGTTGGTATTCAGGTTCGAAATGCTCGAGCATTTCGAACCTGAATACCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-267s21c1
Sequence:CCGGTATGGGAGATGAACGTGTAAACTCGAGTTTACACGTTCATCTCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232425    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004882.3-216s21c1
Sequence:CCGGATTGATGCAGCAATATCTTAACTCGAGTTAAGATATTGCTGCATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107865    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004882.3-1593s1c1
Sequence:CCGGGACTGTCAATTCAAGTACAAACTCGAGTTTGTACTTGAATTGACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_004882.3-142s1c1
Sequence:CCGGGCCTCCAAATCCAATATCAAACTCGAGTTTGATATTGGATTTGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004882.3-1407s1c1
Sequence:CCGGCCCAGGAGGTACACATACTAACTCGAGTTAGTATGTGTACCTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004882.3-279s1c1
Sequence:CCGGACGTGTAAAGAATGGCCTTAACTCGAGTTAAGGCCATTCTTTACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004882.3-280s1c1
Sequence:CCGGCGTGTAAAGAATGGCCTTAATCTCGAGATTAAGGCCATTCTTTACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks