EMAIL THIS PAGE TO A FRIEND

CIRBP-AS1

CIRBP antisense RNA 1

15 Gene Product Result for
Synonyms: C19orf23
Species: Human CIRBP-AS1(148046)
UniProtKB ID: Q8TBR5
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152480 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152480 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152480 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152480 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152480 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208901 predicted 497
2 SASI_Hs01_00208908 predicted 766
3 SASI_Hs02_00366255 predicted 762
4 SASI_Hs01_00208902 predicted 779
5 SASI_Hs01_00208906 predicted 286
6 SASI_Hs01_00208907 predicted 292
7 SASI_Hs02_00366256 predicted 671
8 SASI_Hs01_00208900 predicted 468
9 SASI_Hs01_00208903 predicted 381
10 SASI_Hs01_00208909 predicted 393
11 SASI_Hs01_00208904 predicted 774
12 SASI_Hs01_00208905 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152480
CIRBP-AS1 MISSION shRNA Bacterial Glycerol Stock
CIRBP antisense RNA 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152480.1-165s1c1
Sequence:CCGGGCATTTAGGAGAACTGGCTATCTCGAGATAGCCAGTTCTCCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152480.1-210s1c1
Sequence:CCGGCAGACAAAGCATTCACTGGCTCTCGAGAGCCAGTGAATGCTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152480.1-484s1c1
Sequence:CCGGCCATCTGGAGAACCAGCTTTACTCGAGTAAAGCTGGTTCTCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152480.1-395s1c1
Sequence:CCGGCTCATGCAATCGCAATGGGAACTCGAGTTCCCATTGCGATTGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152480.1-981s1c1
Sequence:CCGGCGCAGGGTGGTTATTAAAGGACTCGAGTCCTTTAATAACCACCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152480.1-159s1c1
Sequence:CCGGGAAGTGGCATTTAGGAGAACTCTCGAGAGTTCTCCTAAATGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152480
CIRBP-AS1 MISSION shRNA shRNA Plasmid DNA
CIRBP antisense RNA 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152480.1-165s1c1
Sequence:CCGGGCATTTAGGAGAACTGGCTATCTCGAGATAGCCAGTTCTCCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152480.1-210s1c1
Sequence:CCGGCAGACAAAGCATTCACTGGCTCTCGAGAGCCAGTGAATGCTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152480.1-484s1c1
Sequence:CCGGCCATCTGGAGAACCAGCTTTACTCGAGTAAAGCTGGTTCTCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152480.1-395s1c1
Sequence:CCGGCTCATGCAATCGCAATGGGAACTCGAGTTCCCATTGCGATTGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152480.1-981s1c1
Sequence:CCGGCGCAGGGTGGTTATTAAAGGACTCGAGTCCTTTAATAACCACCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152480.1-159s1c1
Sequence:CCGGGAAGTGGCATTTAGGAGAACTCTCGAGAGTTCTCCTAAATGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152480
CIRBP-AS1 MISSION shRNA Lentiviral Transduction Particles
CIRBP antisense RNA 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152480.1-165s1c1
Sequence:CCGGGCATTTAGGAGAACTGGCTATCTCGAGATAGCCAGTTCTCCTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152480.1-210s1c1
Sequence:CCGGCAGACAAAGCATTCACTGGCTCTCGAGAGCCAGTGAATGCTTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152480.1-484s1c1
Sequence:CCGGCCATCTGGAGAACCAGCTTTACTCGAGTAAAGCTGGTTCTCCAGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152480.1-395s1c1
Sequence:CCGGCTCATGCAATCGCAATGGGAACTCGAGTTCCCATTGCGATTGCATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141474    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152480.1-981s1c1
Sequence:CCGGCGCAGGGTGGTTATTAAAGGACTCGAGTCCTTTAATAACCACCCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143178    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152480.1-159s1c1
Sequence:CCGGGAAGTGGCATTTAGGAGAACTCTCGAGAGTTCTCCTAAATGCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks