EMAIL THIS PAGE TO A FRIEND

CIRBP

cold inducible RNA binding protein

122 Gene Product Result for
Synonyms: CIRP
UniProtKB ID: Q14011
Gene ID:
Mouse(12696) cold inducible RNA binding protein
Rat(81825) cold inducible RNA binding protein
Zebrafish(678563) cold inducible RNA binding protein
cow(507120) cold inducible RNA binding protein
domestic cat(101085782) cold inducible RNA binding protein
dog(476755) cold inducible RNA binding protein
chicken(425789) cold inducible RNA binding protein
sheep(101117758) cold inducible RNA binding protein
domestic guinea pig(100731683) cold inducible RNA binding protein
naked mole-rat(101704185) cold inducible RNA binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007705 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007705 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007705 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001280 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001280 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001280 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001280 Rosetta Predictions human pricing
NR_023312 Rosetta Predictions human pricing
NR_023313 Rosetta Predictions human pricing
NM_031147 Rosetta Predictions rat pricing
NM_007705 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001280 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172352 predicted 577
2 SASI_Hs02_00331508 predicted 627
3 SASI_Hs02_00331509 predicted 622
4 SASI_Hs01_00172355 predicted 648
5 SASI_Hs02_00331510 predicted 625
6 SASI_Hs02_00331511 predicted 620
7 SASI_Hs02_00331512 predicted 633
8 SASI_Hs01_00172359 predicted 643
9 SASI_Hs02_00331513 predicted 632
10 SASI_Hs02_00331514 predicted 374
11 SASI_Hs01_00172353 predicted 274
12 SASI_Hs01_00172354 predicted 561
13 SASI_Hs01_00172356 predicted 272
14 SASI_Hs01_00172357 predicted 565
15 SASI_Hs01_00172358 predicted 277
16 SASI_Hs01_00172360 predicted 301
17 SASI_Hs01_00172361 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381602 predicted 2852
2 SASI_Hs02_00381603 predicted 692
3 SASI_Hs02_00381604 predicted 2939
4 SASI_Hs02_00381605 predicted 2703
5 SASI_Hs02_00381606 predicted 2211
6 SASI_Hs02_00381607 predicted 438
7 SASI_Hs02_00381608 predicted 2707
8 SASI_Hs02_00381609 predicted 399
9 SASI_Hs02_00381610 predicted 2754
10 SASI_Hs02_00381611 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_023313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00381612 predicted 2682
2 SASI_Hs02_00381613 predicted 2020
3 SASI_Hs02_00381614 predicted 509
4 SASI_Hs02_00381615 predicted 2749
5 SASI_Hs02_00381616 predicted 1913
6 SASI_Hs02_00381617 predicted 2582
7 SASI_Hs02_00381618 predicted 528
8 SASI_Hs02_00381619 predicted 516
9 SASI_Hs02_00381620 predicted 2765
10 SASI_Hs02_00381621 predicted 2543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031147 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032541 predicted 655
2 SASI_Rn01_00032542 predicted 699
3 SASI_Rn01_00032543 predicted 264
4 SASI_Rn01_00032545 predicted 527
5 SASI_Rn01_00032547 predicted 528
6 SASI_Rn01_00032548 predicted 561
7 SASI_Rn01_00032549 predicted 361
8 SASI_Rn02_00264488 predicted 359
9 SASI_Rn02_00264489 predicted 276
10 SASI_Rn02_00264490 predicted 661
11 SASI_Rn01_00032544 predicted 715
12 SASI_Rn01_00032546 predicted 264
13 SASI_Rn01_00032550 predicted 653
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007705 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00312269 predicted 267
2 SASI_Mm01_00181874 predicted 516
3 SASI_Mm01_00181875 predicted 575
4 SASI_Mm01_00181876 predicted 657
5 SASI_Mm01_00181877 predicted 478
6 SASI_Mm01_00181878 predicted 615
7 SASI_Mm01_00181879 predicted 268
8 SASI_Mm01_00181880 predicted 550
9 SASI_Mm01_00181882 predicted 440
10 SASI_Mm01_00181883 predicted 578
11 SASI_Mm01_00181881 predicted 563
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007705
VALIDATED
CIRBP MISSION shRNA Bacterial Glycerol Stock
cold inducible RNA binding protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000102345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007705.1-621s1c1
Sequence:CCGGCGTCCTTCCATGGCTGTAATTCTCGAGAATTACAGCCATGGAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007705.1-266s1c1
Sequence:CCGGGACGCCATGATGGCTATGAATCTCGAGATTCATAGCCATCATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007705.1-562s1c1
Sequence:CCGGCAGAGACAGCTATGACAGTTACTCGAGTAACTGTCATAGCTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000102349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007705.1-574s1c1
Sequence:CCGGTGACAGTTATGCTACACACAACTCGAGTTGTGTGTAGCATAACTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-582s21c1
Sequence:CCGGATGCTACACACAACGAGTAAACTCGAGTTTACTCGTTGTGTGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-267s21c1
Sequence:CCGGACGCCATGATGGCTATGAATGCTCGAGCATTCATAGCCATCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-521s21c1
Sequence:CCGGCAGGGTGGCAGCTATGGTTATCTCGAGATAACCATAGCTGCCACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-178s21c1
Sequence:CCGGCTCCGAAGTGGTGGTGGTAAACTCGAGTTTACCACCACCACTTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007705.2-620s21c1
Sequence:CCGGTCGTCCTTCCATGGCTGTAATCTCGAGATTACAGCCATGGAAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007705
VALIDATED
CIRBP MISSION shRNA shRNA Plasmid DNA
cold inducible RNA binding protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000102345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007705.1-621s1c1
Sequence:CCGGCGTCCTTCCATGGCTGTAATTCTCGAGAATTACAGCCATGGAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007705.1-266s1c1
Sequence:CCGGGACGCCATGATGGCTATGAATCTCGAGATTCATAGCCATCATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007705.1-562s1c1
Sequence:CCGGCAGAGACAGCTATGACAGTTACTCGAGTAACTGTCATAGCTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000102349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007705.1-574s1c1
Sequence:CCGGTGACAGTTATGCTACACACAACTCGAGTTGTGTGTAGCATAACTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-582s21c1
Sequence:CCGGATGCTACACACAACGAGTAAACTCGAGTTTACTCGTTGTGTGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-267s21c1
Sequence:CCGGACGCCATGATGGCTATGAATGCTCGAGCATTCATAGCCATCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-521s21c1
Sequence:CCGGCAGGGTGGCAGCTATGGTTATCTCGAGATAACCATAGCTGCCACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-178s21c1
Sequence:CCGGCTCCGAAGTGGTGGTGGTAAACTCGAGTTTACCACCACCACTTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007705.2-620s21c1
Sequence:CCGGTCGTCCTTCCATGGCTGTAATCTCGAGATTACAGCCATGGAAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007705
VALIDATED
CIRBP MISSION shRNA Lentiviral Transduction Particles
cold inducible RNA binding protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000102345    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007705.1-621s1c1
Sequence:CCGGCGTCCTTCCATGGCTGTAATTCTCGAGAATTACAGCCATGGAAGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007705.1-266s1c1
Sequence:CCGGGACGCCATGATGGCTATGAATCTCGAGATTCATAGCCATCATGGCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_007705.1-562s1c1
Sequence:CCGGCAGAGACAGCTATGACAGTTACTCGAGTAACTGTCATAGCTGTCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000102349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007705.1-574s1c1
Sequence:CCGGTGACAGTTATGCTACACACAACTCGAGTTGTGTGTAGCATAACTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340155    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-582s21c1
Sequence:CCGGATGCTACACACAACGAGTAAACTCGAGTTTACTCGTTGTGTGTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-267s21c1
Sequence:CCGGACGCCATGATGGCTATGAATGCTCGAGCATTCATAGCCATCATGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340085    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-521s21c1
Sequence:CCGGCAGGGTGGCAGCTATGGTTATCTCGAGATAACCATAGCTGCCACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007705.2-178s21c1
Sequence:CCGGCTCCGAAGTGGTGGTGGTAAACTCGAGTTTACCACCACCACTTCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340156    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007705.2-620s21c1
Sequence:CCGGTCGTCCTTCCATGGCTGTAATCTCGAGATTACAGCCATGGAAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001280
VALIDATED
CIRBP MISSION shRNA Bacterial Glycerol Stock
cold inducible RNA binding protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001280.1-572s1c1
Sequence:CCGGCGACAGTTACGCTACACACAACTCGAGTTGTGTGTAGCGTAACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001280.1-487s1c1
Sequence:CCGGGAGGCTCCAGAGACTACTATACTCGAGTATAGTAGTCTCTGGAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001280.1-551s1c1
Sequence:CCGGCGGGTCCTACAGAGACAGTTACTCGAGTAACTGTCTCTGTAGGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001280.1-155s1c1
Sequence:CCGGCTTCTCAAAGTACGGACAGATCTCGAGATCTGTCCGTACTTTGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001280.1-276s1c1
Sequence:CCGGGCCATGAATGGGAAGTCTGTACTCGAGTACAGACTTCCCATTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-312s21c1
Sequence:CCGGGAGAACATTGACGACGCTAAGCTCGAGCTTAGCGTCGTCAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-398s21c1
Sequence:CCGGCAAGTCGTCAGACAACCGATCCTCGAGGATCGGTTGTCTGACGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001280.2-649s21c1
Sequence:CCGGACGCTACACACAACGAGTAAACTCGAGTTTACTCGTTGTGTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001280.2-734s21c1
Sequence:CCGGGAACGTTAATGTGTAGTAAATCTCGAGATTTACTACACATTAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-622s21c1
Sequence:CCGGGGTCCTACAGAGACAGTTATGCTCGAGCATAACTGTCTCTGTAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-768s21c1
Sequence:CCGGTTCCCACTTTCGTAGTCATTTCTCGAGAAATGACTACGAAAGTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001280
VALIDATED
CIRBP MISSION shRNA shRNA Plasmid DNA
cold inducible RNA binding protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001280.1-572s1c1
Sequence:CCGGCGACAGTTACGCTACACACAACTCGAGTTGTGTGTAGCGTAACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001280.1-487s1c1
Sequence:CCGGGAGGCTCCAGAGACTACTATACTCGAGTATAGTAGTCTCTGGAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001280.1-551s1c1
Sequence:CCGGCGGGTCCTACAGAGACAGTTACTCGAGTAACTGTCTCTGTAGGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001280.1-155s1c1
Sequence:CCGGCTTCTCAAAGTACGGACAGATCTCGAGATCTGTCCGTACTTTGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001280.1-276s1c1
Sequence:CCGGGCCATGAATGGGAAGTCTGTACTCGAGTACAGACTTCCCATTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-312s21c1
Sequence:CCGGGAGAACATTGACGACGCTAAGCTCGAGCTTAGCGTCGTCAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-398s21c1
Sequence:CCGGCAAGTCGTCAGACAACCGATCCTCGAGGATCGGTTGTCTGACGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001280.2-649s21c1
Sequence:CCGGACGCTACACACAACGAGTAAACTCGAGTTTACTCGTTGTGTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001280.2-734s21c1
Sequence:CCGGGAACGTTAATGTGTAGTAAATCTCGAGATTTACTACACATTAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-622s21c1
Sequence:CCGGGGTCCTACAGAGACAGTTATGCTCGAGCATAACTGTCTCTGTAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-768s21c1
Sequence:CCGGTTCCCACTTTCGTAGTCATTTCTCGAGAAATGACTACGAAAGTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001280
VALIDATED
CIRBP MISSION shRNA Lentiviral Transduction Particles
cold inducible RNA binding protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001280.1-572s1c1
Sequence:CCGGCGACAGTTACGCTACACACAACTCGAGTTGTGTGTAGCGTAACTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_001280.1-487s1c1
Sequence:CCGGGAGGCTCCAGAGACTACTATACTCGAGTATAGTAGTCTCTGGAGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001280.1-551s1c1
Sequence:CCGGCGGGTCCTACAGAGACAGTTACTCGAGTAACTGTCTCTGTAGGACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_001280.1-155s1c1
Sequence:CCGGCTTCTCAAAGTACGGACAGATCTCGAGATCTGTCCGTACTTTGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017265    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001280.1-276s1c1
Sequence:CCGGGCCATGAATGGGAAGTCTGTACTCGAGTACAGACTTCCCATTCATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-312s21c1
Sequence:CCGGGAGAACATTGACGACGCTAAGCTCGAGCTTAGCGTCGTCAATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-398s21c1
Sequence:CCGGCAAGTCGTCAGACAACCGATCCTCGAGGATCGGTTGTCTGACGACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001280.2-649s21c1
Sequence:CCGGACGCTACACACAACGAGTAAACTCGAGTTTACTCGTTGTGTGTAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364810    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001280.2-734s21c1
Sequence:CCGGGAACGTTAATGTGTAGTAAATCTCGAGATTTACTACACATTAACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-622s21c1
Sequence:CCGGGGTCCTACAGAGACAGTTATGCTCGAGCATAACTGTCTCTGTAGGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369654    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_001280.2-768s21c1
Sequence:CCGGTTCCCACTTTCGTAGTCATTTCTCGAGAAATGACTACGAAAGTGGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks