EMAIL THIS PAGE TO A FRIEND

CISD1

CDGSH iron sulfur domain 1

81 Gene Product Result for
Synonyms: C10orf70 ZCD1 mitoNEET
UniProtKB ID: Q9NZ45, Q1X902
Gene ID:
Human(55847) Summary: This gene encodes a protein with a CDGSH iron-sulfur domain and has been shown to bind a redox-active [2Fe-2S]
Mouse(52637) CDGSH iron sulfur domain 1
Rat(294362) CDGSH iron sulfur domain 1
Zebrafish(393577) CDGSH iron sulfur domain 1
cow(531444) CDGSH iron sulfur domain 1
domestic cat(101096415) CDGSH iron sulfur domain 1
dog(479212) CDGSH iron sulfur domain 1
chicken(423642) CDGSH iron sulfur domain 1
domestic guinea pig(100724674) CDGSH iron sulfur domain 1
naked mole-rat(101699751) CDGSH iron sulfur domain 1
Goat(100861090) CDGSH iron sulfur domain 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018464 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018464 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018464 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU042791 MISSION® esiRNA esiRNA targeting mouse Cisd1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018464 Rosetta Predictions human pricing
NM_001106385 Rosetta Predictions rat pricing
NM_134007 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018464 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205865 predicted 422
2 SASI_Hs02_00352024 predicted 206
3 SASI_Hs02_00352025 predicted 911
4 SASI_Hs02_00352026 predicted 876
5 SASI_Hs01_00205870 predicted 417
6 SASI_Hs01_00205872 predicted 241
7 SASI_Hs02_00352027 predicted 879
8 SASI_Hs02_00352028 predicted 891
9 SASI_Hs02_00352029 predicted 248
10 SASI_Hs02_00352030 predicted 493
11 SASI_Hs01_00205866 predicted 338
12 SASI_Hs01_00205867 predicted 221
13 SASI_Hs01_00205868 predicted 222
14 SASI_Hs01_00205869 predicted 334
15 SASI_Hs01_00205871 predicted 244
16 SASI_Hs01_00205873 predicted 326
17 SASI_Hs01_00205874 predicted 329
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218448 predicted 499
2 SASI_Rn02_00218449 predicted 450
3 SASI_Rn02_00218450 predicted 436
4 SASI_Rn02_00218451 predicted 240
5 SASI_Rn02_00218452 predicted 443
6 SASI_Rn02_00218453 predicted 230
7 SASI_Rn02_00218454 predicted 440
8 SASI_Rn02_00218455 predicted 434
9 SASI_Rn02_00218456 predicted 434
10 SASI_Rn02_00218457 predicted 482
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134007 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117193 predicted 447
2 SASI_Mm01_00117194 predicted 676
3 SASI_Mm02_00339149 predicted 197
4 SASI_Mm01_00117195 predicted 210
5 SASI_Mm01_00117196 predicted 544
6 SASI_Mm01_00117197 predicted 622
7 SASI_Mm01_00117199 predicted 568
8 SASI_Mm02_00339150 predicted 454
9 SASI_Mm02_00339151 predicted 210
10 SASI_Mm01_00117201 predicted 613
11 SASI_Mm01_00117198 predicted 375
12 SASI_Mm01_00117200 predicted 607
13 SASI_Mm01_00117202 predicted 349
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134007
VALIDATED
CISD1 MISSION shRNA Bacterial Glycerol Stock
CDGSH iron sulfur domain 1
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000292734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-201s21c1
Sequence:CCGGGCTAAAGAGAATCGCACCAAACTCGAGTTTGGTGCGATTCTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-239s21c1
Sequence:CCGGGATCCAGAAAGACAACCCGAACTCGAGTTCGGGTTGTCTTTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134007.4-684s1c1
Sequence:CCGGGTCTTAGAATATAGTTGTATCCTCGAGGATACAACTATATTCTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134007.4-538s1c1
Sequence:CCGGGCAAATCACAGCTCTCATATCCTCGAGGATATGAGAGCTGTGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217545    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134007.4-463s1c1
Sequence:CCGGCCTGCTGATTTACGTAGAATGCTCGAGCATTCTACGTAAATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-386s21c1
Sequence:CCGGCGTAGGACCTCTGATCATCAACTCGAGTTGATGATCAGAGGTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-351s21c1
Sequence:CCGGGCTCACATAAAGCACAACGAACTCGAGTTCGTTGTGCTTTATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134007.2-180s1c1
Sequence:CCGGCCTGGCTTACAAGAAGTTCTACTCGAGTAGAACTTCTTGTAAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134007.2-202s1c1
Sequence:CCGGGCTAAAGAGAATCGCACCAAACTCGAGTTTGGTGCGATTCTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134007.2-352s1c1
Sequence:CCGGGCTCACATAAAGCACAACGAACTCGAGTTCGTTGTGCTTTATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134007.2-387s1c1
Sequence:CCGGCGTAGGACCTCTGATCATCAACTCGAGTTGATGATCAGAGGTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134007.2-240s1c1
Sequence:CCGGGATCCAGAAAGACAACCCGAACTCGAGTTCGGGTTGTCTTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134007.2-593s1c1
Sequence:CCGGGCACGTTTGTTGAAAGAAGAACTCGAGTTCTTCTTTCAACAAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134007
VALIDATED
CISD1 MISSION shRNA shRNA Plasmid DNA
CDGSH iron sulfur domain 1
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000292734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-201s21c1
Sequence:CCGGGCTAAAGAGAATCGCACCAAACTCGAGTTTGGTGCGATTCTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-239s21c1
Sequence:CCGGGATCCAGAAAGACAACCCGAACTCGAGTTCGGGTTGTCTTTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134007.4-684s1c1
Sequence:CCGGGTCTTAGAATATAGTTGTATCCTCGAGGATACAACTATATTCTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134007.4-538s1c1
Sequence:CCGGGCAAATCACAGCTCTCATATCCTCGAGGATATGAGAGCTGTGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217545    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134007.4-463s1c1
Sequence:CCGGCCTGCTGATTTACGTAGAATGCTCGAGCATTCTACGTAAATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-386s21c1
Sequence:CCGGCGTAGGACCTCTGATCATCAACTCGAGTTGATGATCAGAGGTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-351s21c1
Sequence:CCGGGCTCACATAAAGCACAACGAACTCGAGTTCGTTGTGCTTTATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134007.2-180s1c1
Sequence:CCGGCCTGGCTTACAAGAAGTTCTACTCGAGTAGAACTTCTTGTAAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134007.2-202s1c1
Sequence:CCGGGCTAAAGAGAATCGCACCAAACTCGAGTTTGGTGCGATTCTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134007.2-352s1c1
Sequence:CCGGGCTCACATAAAGCACAACGAACTCGAGTTCGTTGTGCTTTATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134007.2-387s1c1
Sequence:CCGGCGTAGGACCTCTGATCATCAACTCGAGTTGATGATCAGAGGTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134007.2-240s1c1
Sequence:CCGGGATCCAGAAAGACAACCCGAACTCGAGTTCGGGTTGTCTTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134007.2-593s1c1
Sequence:CCGGGCACGTTTGTTGAAAGAAGAACTCGAGTTCTTCTTTCAACAAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134007
VALIDATED
CISD1 MISSION shRNA Lentiviral Transduction Particles
CDGSH iron sulfur domain 1
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000292734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-201s21c1
Sequence:CCGGGCTAAAGAGAATCGCACCAAACTCGAGTTTGGTGCGATTCTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-239s21c1
Sequence:CCGGGATCCAGAAAGACAACCCGAACTCGAGTTCGGGTTGTCTTTCTGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215667    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134007.4-684s1c1
Sequence:CCGGGTCTTAGAATATAGTTGTATCCTCGAGGATACAACTATATTCTAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134007.4-538s1c1
Sequence:CCGGGCAAATCACAGCTCTCATATCCTCGAGGATATGAGAGCTGTGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217545    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_134007.4-463s1c1
Sequence:CCGGCCTGCTGATTTACGTAGAATGCTCGAGCATTCTACGTAAATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-386s21c1
Sequence:CCGGCGTAGGACCTCTGATCATCAACTCGAGTTGATGATCAGAGGTCCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292662    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134007.4-351s21c1
Sequence:CCGGGCTCACATAAAGCACAACGAACTCGAGTTCGTTGTGCTTTATGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_134007.2-180s1c1
Sequence:CCGGCCTGGCTTACAAGAAGTTCTACTCGAGTAGAACTTCTTGTAAGCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134007.2-202s1c1
Sequence:CCGGGCTAAAGAGAATCGCACCAAACTCGAGTTTGGTGCGATTCTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134007.2-352s1c1
Sequence:CCGGGCTCACATAAAGCACAACGAACTCGAGTTCGTTGTGCTTTATGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134007.2-387s1c1
Sequence:CCGGCGTAGGACCTCTGATCATCAACTCGAGTTGATGATCAGAGGTCCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190774    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134007.2-240s1c1
Sequence:CCGGGATCCAGAAAGACAACCCGAACTCGAGTTCGGGTTGTCTTTCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191883    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134007.2-593s1c1
Sequence:CCGGGCACGTTTGTTGAAAGAAGAACTCGAGTTCTTCTTTCAACAAACGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018464
VALIDATED
CISD1 MISSION shRNA Bacterial Glycerol Stock
CDGSH iron sulfur domain 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000278359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-329s21c1
Sequence:CCGGGATTTGGGAGATAAAGCTGTGCTCGAGCACAGCTTTATCTCCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-557s21c1
Sequence:CCGGGCTGGATTCTAAATGTGGTATCTCGAGATACCACATTTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-209s21c1
Sequence:CCGGGCTGCAATTGGTTATCTAGCTCTCGAGAGCTAGATAACCAATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-412s21c1
Sequence:CCGGCGAAGAGACTGGAGACAATGTCTCGAGACATTGTCTCCAGTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-271s21c1
Sequence:CCGGGATAAACCTTCACATCCAGAACTCGAGTTCTGGATGTGAAGGTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-384s1c1
Sequence:CCGGCGAAGAGACTGGAGACAATGTCTCGAGACATTGTCTCCAGTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-301s1c1
Sequence:CCGGGATTTGGGAGATAAAGCTGTGCTCGAGCACAGCTTTATCTCCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-181s1c1
Sequence:CCGGGCTGCAATTGGTTATCTAGCTCTCGAGAGCTAGATAACCAATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.2-537s1c1
Sequence:CCGGGCTGGATTCTAAATGTGGTATCTCGAGATACCACATTTAGAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-243s1c1
Sequence:CCGGGATAAACCTTCACATCCAGAACTCGAGTTCTGGATGTGAAGGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-184s1c1
Sequence:CCGGGCAATTGGTTATCTAGCTTACCTCGAGGTAAGCTAGATAACCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-179s1c1
Sequence:CCGGCAGCTGCAATTGGTTATCTAGCTCGAGCTAGATAACCAATTGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-177s1c1
Sequence:CCGGGACAGCTGCAATTGGTTATCTCTCGAGAGATAACCAATTGCAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-310s1c1
Sequence:CCGGGATAAAGCTGTGTACTGCCGTCTCGAGACGGCAGTACACAGCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018464
VALIDATED
CISD1 MISSION shRNA shRNA Plasmid DNA
CDGSH iron sulfur domain 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000278359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-329s21c1
Sequence:CCGGGATTTGGGAGATAAAGCTGTGCTCGAGCACAGCTTTATCTCCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-557s21c1
Sequence:CCGGGCTGGATTCTAAATGTGGTATCTCGAGATACCACATTTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-209s21c1
Sequence:CCGGGCTGCAATTGGTTATCTAGCTCTCGAGAGCTAGATAACCAATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-412s21c1
Sequence:CCGGCGAAGAGACTGGAGACAATGTCTCGAGACATTGTCTCCAGTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-271s21c1
Sequence:CCGGGATAAACCTTCACATCCAGAACTCGAGTTCTGGATGTGAAGGTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-384s1c1
Sequence:CCGGCGAAGAGACTGGAGACAATGTCTCGAGACATTGTCTCCAGTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-301s1c1
Sequence:CCGGGATTTGGGAGATAAAGCTGTGCTCGAGCACAGCTTTATCTCCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-181s1c1
Sequence:CCGGGCTGCAATTGGTTATCTAGCTCTCGAGAGCTAGATAACCAATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.2-537s1c1
Sequence:CCGGGCTGGATTCTAAATGTGGTATCTCGAGATACCACATTTAGAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-243s1c1
Sequence:CCGGGATAAACCTTCACATCCAGAACTCGAGTTCTGGATGTGAAGGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-184s1c1
Sequence:CCGGGCAATTGGTTATCTAGCTTACCTCGAGGTAAGCTAGATAACCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-179s1c1
Sequence:CCGGCAGCTGCAATTGGTTATCTAGCTCGAGCTAGATAACCAATTGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-177s1c1
Sequence:CCGGGACAGCTGCAATTGGTTATCTCTCGAGAGATAACCAATTGCAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-310s1c1
Sequence:CCGGGATAAAGCTGTGTACTGCCGTCTCGAGACGGCAGTACACAGCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018464
VALIDATED
CISD1 MISSION shRNA Lentiviral Transduction Particles
CDGSH iron sulfur domain 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000278359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-329s21c1
Sequence:CCGGGATTTGGGAGATAAAGCTGTGCTCGAGCACAGCTTTATCTCCCAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-557s21c1
Sequence:CCGGGCTGGATTCTAAATGTGGTATCTCGAGATACCACATTTAGAATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-209s21c1
Sequence:CCGGGCTGCAATTGGTTATCTAGCTCTCGAGAGCTAGATAACCAATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-412s21c1
Sequence:CCGGCGAAGAGACTGGAGACAATGTCTCGAGACATTGTCTCCAGTCTCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_018464.3-271s21c1
Sequence:CCGGGATAAACCTTCACATCCAGAACTCGAGTTCTGGATGTGAAGGTTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-384s1c1
Sequence:CCGGCGAAGAGACTGGAGACAATGTCTCGAGACATTGTCTCCAGTCTCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-301s1c1
Sequence:CCGGGATTTGGGAGATAAAGCTGTGCTCGAGCACAGCTTTATCTCCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-181s1c1
Sequence:CCGGGCTGCAATTGGTTATCTAGCTCTCGAGAGCTAGATAACCAATTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.2-537s1c1
Sequence:CCGGGCTGGATTCTAAATGTGGTATCTCGAGATACCACATTTAGAATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-243s1c1
Sequence:CCGGGATAAACCTTCACATCCAGAACTCGAGTTCTGGATGTGAAGGTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-184s1c1
Sequence:CCGGGCAATTGGTTATCTAGCTTACCTCGAGGTAAGCTAGATAACCAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152431    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018464.1-179s1c1
Sequence:CCGGCAGCTGCAATTGGTTATCTAGCTCGAGCTAGATAACCAATTGCAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-177s1c1
Sequence:CCGGGACAGCTGCAATTGGTTATCTCTCGAGAGATAACCAATTGCAGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_018464.1-310s1c1
Sequence:CCGGGATAAAGCTGTGTACTGCCGTCTCGAGACGGCAGTACACAGCTTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks