EMAIL THIS PAGE TO A FRIEND

CISD2

CDGSH iron sulfur domain 2

Synonyms: ERIS Miner1 NAF-1 WFS2 ZCD2
UniProtKB ID: Q8N5K1, Q7Z3D5
Gene ID:
Human(493856) Summary: The protein encoded by this gene is a zinc finger protein that localizes to the endoplasmic reticulum. The encoded protein binds an iron/sulfur cluster and may be involved in calcium homeostasis. Defects in this gene are a cause of Wolfram syndrome 2. [provided by RefSeq, Mar 2011]
Mouse(67006) CDGSH iron sulfur domain 2
Rat(295457) CDGSH iron sulfur domain 2
Zebrafish(393354) CDGSH iron sulfur domain 2
cow(781260) CDGSH iron sulfur domain 2
domestic cat(101094592) CDGSH iron sulfur domain 2
dog(610084) CDGSH iron sulfur domain 2
chicken(422714) CDGSH iron sulfur domain 2
sheep(101106939) CDGSH iron sulfur domain 2
naked mole-rat(101724878) CDGSH iron sulfur domain 2
domestic guinea pig(100716445) CDGSH iron sulfur domain 2
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015914 Anti-CISD2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV44552 Anti-CISD2 antibody produced in rabbit affinity isolated antibody canine, zebrafish, rabbit, bovine, human, rat, guinea pig, mouse
western blot pricing
SAB3500866 Anti-CISD2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025902 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025902 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025902 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001008388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001008388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001008388 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008388 Rosetta Predictions human pricing
XM_001077768 Rosetta Predictions rat pricing
XM_215704 Rosetta Predictions rat pricing
NM_025902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066607 predicted 275
2 SASI_Hs01_00066608 predicted 629
3 SASI_Hs01_00066609 predicted 359
4 SASI_Hs01_00066610 predicted 454
5 SASI_Hs01_00066611 predicted 300
6 SASI_Hs01_00066612 predicted 643
7 SASI_Hs01_00066613 predicted 345
8 SASI_Hs01_00066614 predicted 575
9 SASI_Hs01_00066615 predicted 435
10 SASI_Hs01_00066616 predicted 464
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00358487 predicted 576
2 SASI_Rn02_00358488 predicted 818
3 SASI_Rn02_00358489 predicted 553
4 SASI_Rn02_00358490 predicted 463
5 SASI_Rn02_00358491 predicted 833
6 SASI_Rn02_00358492 predicted 724
7 SASI_Rn02_00358493 predicted 545
8 SASI_Rn02_00358494 predicted 611
9 SASI_Rn02_00358495 predicted 590
10 SASI_Rn02_00358496 predicted 578
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376135 predicted 574
2 SASI_Rn02_00376136 predicted 815
3 SASI_Rn02_00376137 predicted 547
4 SASI_Rn02_00376138 predicted 459
5 SASI_Rn02_00376139 predicted 831
6 SASI_Rn02_00376140 predicted 727
7 SASI_Rn02_00376141 predicted 542
8 SASI_Rn02_00376142 predicted 608
9 SASI_Rn02_00376143 predicted 594
10 SASI_Rn02_00376144 predicted 572
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077568 predicted 405
2 SASI_Mm01_00077569 predicted 270
3 SASI_Mm01_00077570 predicted 610
4 SASI_Mm01_00077571 predicted 558
5 SASI_Mm01_00077572 predicted 271
6 SASI_Mm01_00077573 predicted 428
7 SASI_Mm01_00077575 predicted 398
8 SASI_Mm01_00077576 predicted 610
9 SASI_Mm02_00329256 predicted 773
10 SASI_Mm02_00329257 predicted 589
11 SASI_Mm01_00077574 predicted 265
12 SASI_Mm01_00077577 predicted 488
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025902
VALIDATED
CISD2 MISSION shRNA Bacterial Glycerol Stock
CDGSH iron sulfur domain 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025902.2-1712s1c1
Sequence:CCGGCCCGAGTGATAAGACCTGATTCTCGAGAATCAGGTCTTATCACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025902.2-310s1c1
Sequence:CCGGCCCAAGGTGGTGAATGAGATACTCGAGTATCTCATTCACCACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025902.2-264s1c1
Sequence:CCGGGCAACAGAAGGATAGCTTGATCTCGAGATCAAGCTATCCTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025902.2-420s1c1
Sequence:CCGGGCATAATGAATTGACAGGCGACTCGAGTCGCCTGTCAATTCATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025902.2-347s1c1
Sequence:CCGGGTCTCACCAAAGCAGCTTATTCTCGAGAATAAGCTGCTTTGGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025902.3-611s21c1
Sequence:CCGGCTGCTTATATTTGGTACTTTACTCGAGTAAAGTACCAAATATAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025902.3-407s21c1
Sequence:CCGGGATCCCATAATAAGCATAATGCTCGAGCATTATGCTTATTATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025902.3-273s21c1
Sequence:CCGGGGATAGCTTGATCAATCTTAACTCGAGTTAAGATTGATCAAGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025902.3-348s21c1
Sequence:CCGGTCTCACCAAAGCAGCTTATTGCTCGAGCAATAAGCTGCTTTGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025902
VALIDATED
CISD2 MISSION shRNA shRNA Plasmid DNA
CDGSH iron sulfur domain 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025902.2-1712s1c1
Sequence:CCGGCCCGAGTGATAAGACCTGATTCTCGAGAATCAGGTCTTATCACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025902.2-310s1c1
Sequence:CCGGCCCAAGGTGGTGAATGAGATACTCGAGTATCTCATTCACCACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025902.2-264s1c1
Sequence:CCGGGCAACAGAAGGATAGCTTGATCTCGAGATCAAGCTATCCTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025902.2-420s1c1
Sequence:CCGGGCATAATGAATTGACAGGCGACTCGAGTCGCCTGTCAATTCATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025902.2-347s1c1
Sequence:CCGGGTCTCACCAAAGCAGCTTATTCTCGAGAATAAGCTGCTTTGGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025902.3-611s21c1
Sequence:CCGGCTGCTTATATTTGGTACTTTACTCGAGTAAAGTACCAAATATAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025902.3-407s21c1
Sequence:CCGGGATCCCATAATAAGCATAATGCTCGAGCATTATGCTTATTATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025902.3-273s21c1
Sequence:CCGGGGATAGCTTGATCAATCTTAACTCGAGTTAAGATTGATCAAGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025902.3-348s21c1
Sequence:CCGGTCTCACCAAAGCAGCTTATTGCTCGAGCAATAAGCTGCTTTGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025902
VALIDATED
CISD2 MISSION shRNA Lentiviral Transduction Particles
CDGSH iron sulfur domain 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184132    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025902.2-1712s1c1
Sequence:CCGGCCCGAGTGATAAGACCTGATTCTCGAGAATCAGGTCTTATCACTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025902.2-310s1c1
Sequence:CCGGCCCAAGGTGGTGAATGAGATACTCGAGTATCTCATTCACCACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180680    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025902.2-264s1c1
Sequence:CCGGGCAACAGAAGGATAGCTTGATCTCGAGATCAAGCTATCCTTCTGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025902.2-420s1c1
Sequence:CCGGGCATAATGAATTGACAGGCGACTCGAGTCGCCTGTCAATTCATTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025902.2-347s1c1
Sequence:CCGGGTCTCACCAAAGCAGCTTATTCTCGAGAATAAGCTGCTTTGGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379389    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025902.3-611s21c1
Sequence:CCGGCTGCTTATATTTGGTACTTTACTCGAGTAAAGTACCAAATATAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362853    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025902.3-407s21c1
Sequence:CCGGGATCCCATAATAAGCATAATGCTCGAGCATTATGCTTATTATGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025902.3-273s21c1
Sequence:CCGGGGATAGCTTGATCAATCTTAACTCGAGTTAAGATTGATCAAGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025902.3-348s21c1
Sequence:CCGGTCTCACCAAAGCAGCTTATTGCTCGAGCAATAAGCTGCTTTGGTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001008388
VALIDATED
CISD2 MISSION shRNA Bacterial Glycerol Stock
CDGSH iron sulfur domain 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000167172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008388.1-423s1c1
Sequence:CCGGCCACTAATACTGAAGAAGAAACTCGAGTTTCTTCTTCAGTATTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008388.1-395s1c1
Sequence:CCGGCAATGAATTGACAGGAGATAACTCGAGTTATCTCCTGTCAATTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-308s21c1
Sequence:CCGGGGATAGCTTGATTAATCTTAACTCGAGTTAAGATTAATCAAGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-580s21c1
Sequence:CCGGTACTACTGGTTGAACAATTATCTCGAGATAATTGTTCAACCAGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-473s21c1
Sequence:CCGGAGATAATGTGGGTCCACTAATCTCGAGATTAGTGGACCCACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-372s21c1
Sequence:CCGGGAAGATTTGTGTCTTACTAAACTCGAGTTTAGTAAGACACAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-434s21c1
Sequence:CCGGCTGCGATGGTTCACATAATAACTCGAGTTATTATGTGAACCATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-170s21c1
Sequence:CCGGCCCAGTCCCTGAAAGCATTACCTCGAGGTAATGCTTTCAGGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-401s21c1
Sequence:CCGGTTGTAGGTGTTGGCGTTCTAACTCGAGTTAGAACGCCAACACCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-344s21c1
Sequence:CCGGTCCGAAAGTAGTGAATGAAATCTCGAGATTTCATTCACTACTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008388.3-1079s21c1
Sequence:CCGGCCATTGAGGAACAGTTATTTACTCGAGTAAATAACTGTTCCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-194s21c1
Sequence:CCGGGTTCGCTAGGCTCACAGTTTCCTCGAGGAAACTGTGAGCCTAGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001008388
VALIDATED
CISD2 MISSION shRNA shRNA Plasmid DNA
CDGSH iron sulfur domain 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000167172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008388.1-423s1c1
Sequence:CCGGCCACTAATACTGAAGAAGAAACTCGAGTTTCTTCTTCAGTATTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008388.1-395s1c1
Sequence:CCGGCAATGAATTGACAGGAGATAACTCGAGTTATCTCCTGTCAATTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-308s21c1
Sequence:CCGGGGATAGCTTGATTAATCTTAACTCGAGTTAAGATTAATCAAGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-580s21c1
Sequence:CCGGTACTACTGGTTGAACAATTATCTCGAGATAATTGTTCAACCAGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-473s21c1
Sequence:CCGGAGATAATGTGGGTCCACTAATCTCGAGATTAGTGGACCCACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-372s21c1
Sequence:CCGGGAAGATTTGTGTCTTACTAAACTCGAGTTTAGTAAGACACAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-434s21c1
Sequence:CCGGCTGCGATGGTTCACATAATAACTCGAGTTATTATGTGAACCATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-170s21c1
Sequence:CCGGCCCAGTCCCTGAAAGCATTACCTCGAGGTAATGCTTTCAGGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-401s21c1
Sequence:CCGGTTGTAGGTGTTGGCGTTCTAACTCGAGTTAGAACGCCAACACCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-344s21c1
Sequence:CCGGTCCGAAAGTAGTGAATGAAATCTCGAGATTTCATTCACTACTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008388.3-1079s21c1
Sequence:CCGGCCATTGAGGAACAGTTATTTACTCGAGTAAATAACTGTTCCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-194s21c1
Sequence:CCGGGTTCGCTAGGCTCACAGTTTCCTCGAGGAAACTGTGAGCCTAGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001008388
VALIDATED
CISD2 MISSION shRNA Lentiviral Transduction Particles
CDGSH iron sulfur domain 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000167172    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008388.1-423s1c1
Sequence:CCGGCCACTAATACTGAAGAAGAAACTCGAGTTTCTTCTTCAGTATTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167018    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001008388.1-395s1c1
Sequence:CCGGCAATGAATTGACAGGAGATAACTCGAGTTATCTCCTGTCAATTCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-308s21c1
Sequence:CCGGGGATAGCTTGATTAATCTTAACTCGAGTTAAGATTAATCAAGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239664    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-580s21c1
Sequence:CCGGTACTACTGGTTGAACAATTATCTCGAGATAATTGTTCAACCAGTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-473s21c1
Sequence:CCGGAGATAATGTGGGTCCACTAATCTCGAGATTAGTGGACCCACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-372s21c1
Sequence:CCGGGAAGATTTGTGTCTTACTAAACTCGAGTTTAGTAAGACACAAATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.2-434s21c1
Sequence:CCGGCTGCGATGGTTCACATAATAACTCGAGTTATTATGTGAACCATCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-170s21c1
Sequence:CCGGCCCAGTCCCTGAAAGCATTACCTCGAGGTAATGCTTTCAGGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-401s21c1
Sequence:CCGGTTGTAGGTGTTGGCGTTCTAACTCGAGTTAGAACGCCAACACCTACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282214    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-344s21c1
Sequence:CCGGTCCGAAAGTAGTGAATGAAATCTCGAGATTTCATTCACTACTTTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001008388.3-1079s21c1
Sequence:CCGGCCATTGAGGAACAGTTATTTACTCGAGTAAATAACTGTTCCTCAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_001008388.3-194s21c1
Sequence:CCGGGTTCGCTAGGCTCACAGTTTCCTCGAGGAAACTGTGAGCCTAGCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks