EMAIL THIS PAGE TO A FRIEND

CISH

cytokine inducible SH2-containing protein

100 Gene Product Result for
Synonyms: BACTS2 CIS CIS-1 G18 SOCS
UniProtKB ID: Q9NSE2, B2R9N1, G5E9R1, Q9NS38, Q9Y5R1
Gene ID:
Human(1154) Summary: The protein encoded by this gene contains a SH2 domain and a SOCS box domain. The protein thus belongs to the cytokine-induced STAT inhibitor (CIS), also known as suppressor of cytokine signaling (SOCS) or STAT-induced STAT inhibitor (SSI), protein family. CIS family members are known to be cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by IL2, IL3, GM-CSF and EPO in hematopoietic cells. Proteasome-mediated degradation of this protein has been shown to be involved in the inactivation of the erythropoietin receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(12700) cytokine inducible SH2-containing protein
Rat(83681) cytokine inducible SH2-containing protein
Zebrafish(767678) cytokine inducible SH2-containing protein
chicken(395335) cytokine inducible SH2-containing protein
dog(484757) cytokine inducible SH2-containing protein
cow(616753) cytokine inducible SH2-containing protein
domestic cat(101096550) cytokine inducible SH2-containing protein
sheep(101119259) cytokine inducible SH2-containing protein
naked mole-rat(101716746) cytokine inducible SH2-containing protein
domestic guinea pig(100719354) cytokine inducible SH2-containing protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145071 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145071 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145071 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013324 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009895 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009895 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009895 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145071 Rosetta Predictions human pricing
NM_031804 Rosetta Predictions rat pricing
NM_009895 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145071 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00047055 predicted 1098
2 SASI_Hs01_00047056 predicted 562
3 SASI_Hs01_00047057 predicted 313
4 SASI_Hs01_00047058 predicted 410
5 SASI_Hs01_00047060 predicted 1036
6 SASI_Hs01_00047062 predicted 1143
7 SASI_Hs02_00364969 predicted 304
8 SASI_Hs01_00047063 predicted 419
9 SASI_Hs01_00047064 predicted 591
10 SASI_Hs02_00364970 predicted 615
11 SASI_Hs01_00047059 predicted 1374
12 SASI_Hs01_00047061 predicted 505
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031804 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265251 predicted 1343
2 SASI_Rn02_00265252 predicted 306
3 SASI_Rn02_00265253 predicted 402
4 SASI_Rn02_00265254 predicted 1188
5 SASI_Rn02_00265255 predicted 302
6 SASI_Rn02_00265256 predicted 1224
7 SASI_Rn02_00265257 predicted 492
8 SASI_Rn02_00265258 predicted 531
9 SASI_Rn02_00265259 predicted 495
10 SASI_Rn02_00265260 predicted 309
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009895 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098375 predicted 1258
2 SASI_Mm01_00098376 predicted 1303
3 SASI_Mm02_00317397 predicted 540
4 SASI_Mm01_00098377 predicted 900
5 SASI_Mm01_00098378 predicted 622
6 SASI_Mm01_00098379 predicted 723
7 SASI_Mm01_00098380 predicted 518
8 SASI_Mm01_00098381 predicted 1057
9 SASI_Mm01_00098382 predicted 1276
10 SASI_Mm02_00317398 predicted 924
11 SASI_Mm01_00098374 predicted 1575
12 SASI_Mm01_00098383 predicted 525
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145071
CISH MISSION shRNA Bacterial Glycerol Stock
cytokine inducible SH2-containing protein
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-279s21c1
Sequence:CCGGCAGACAGAGAGTGAGCCAAAGCTCGAGCTTTGGCTCACTCTCTGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-728s21c1
Sequence:CCGGAGCCACTGCTGTACACCTAAACTCGAGTTTAGGTGTACAGCAGTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145071.1-1375s21c1
Sequence:CCGGCTGCACAATTATACACTATTTCTCGAGAAATAGTGTATAATTGTGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-418s21c1
Sequence:CCGGTGCCAGAAGGCACGTTCTTAGCTCGAGCTAAGAACGTGCCTTCTGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-353s21c1
Sequence:CCGGTCGGGAATCTGGCTGGTATTGCTCGAGCAATACCAGCCAGATTCCCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145071
CISH MISSION shRNA shRNA Plasmid DNA
cytokine inducible SH2-containing protein
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-279s21c1
Sequence:CCGGCAGACAGAGAGTGAGCCAAAGCTCGAGCTTTGGCTCACTCTCTGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-728s21c1
Sequence:CCGGAGCCACTGCTGTACACCTAAACTCGAGTTTAGGTGTACAGCAGTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145071.1-1375s21c1
Sequence:CCGGCTGCACAATTATACACTATTTCTCGAGAAATAGTGTATAATTGTGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-418s21c1
Sequence:CCGGTGCCAGAAGGCACGTTCTTAGCTCGAGCTAAGAACGTGCCTTCTGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000232981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-353s21c1
Sequence:CCGGTCGGGAATCTGGCTGGTATTGCTCGAGCAATACCAGCCAGATTCCCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145071
CISH MISSION shRNA Lentiviral Transduction Particles
cytokine inducible SH2-containing protein
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-279s21c1
Sequence:CCGGCAGACAGAGAGTGAGCCAAAGCTCGAGCTTTGGCTCACTCTCTGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-728s21c1
Sequence:CCGGAGCCACTGCTGTACACCTAAACTCGAGTTTAGGTGTACAGCAGTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232984    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145071.1-1375s21c1
Sequence:CCGGCTGCACAATTATACACTATTTCTCGAGAAATAGTGTATAATTGTGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-418s21c1
Sequence:CCGGTGCCAGAAGGCACGTTCTTAGCTCGAGCTAAGAACGTGCCTTCTGGCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000232981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145071.1-353s21c1
Sequence:CCGGTCGGGAATCTGGCTGGTATTGCTCGAGCAATACCAGCCAGATTCCCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013324
VALIDATED
CISH MISSION shRNA Bacterial Glycerol Stock
cytokine inducible SH2-containing protein
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000056694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013324.4-656s1c1
Sequence:CCGGCCACCAATGTACGCATTGAGTCTCGAGACTCAATGCGTACATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013324.4-507s1c1
Sequence:CCGGCCTTCGGGAATCTGGCTGGTACTCGAGTACCAGCCAGATTCCCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013324.4-776s1c1
Sequence:CCGGCCTGCACTGCTGATACCCGAACTCGAGTTCGGGTATCAGCAGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013324.4-480s1c1
Sequence:CCGGGCTGTGCATAGCCAAGACCTTCTCGAGAAGGTCTTGGCTATGCACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013324
VALIDATED
CISH MISSION shRNA shRNA Plasmid DNA
cytokine inducible SH2-containing protein
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000056694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013324.4-656s1c1
Sequence:CCGGCCACCAATGTACGCATTGAGTCTCGAGACTCAATGCGTACATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013324.4-507s1c1
Sequence:CCGGCCTTCGGGAATCTGGCTGGTACTCGAGTACCAGCCAGATTCCCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013324.4-776s1c1
Sequence:CCGGCCTGCACTGCTGATACCCGAACTCGAGTTCGGGTATCAGCAGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000056695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013324.4-480s1c1
Sequence:CCGGGCTGTGCATAGCCAAGACCTTCTCGAGAAGGTCTTGGCTATGCACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013324
VALIDATED
CISH MISSION shRNA Lentiviral Transduction Particles
cytokine inducible SH2-containing protein
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000056694    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013324.4-656s1c1
Sequence:CCGGCCACCAATGTACGCATTGAGTCTCGAGACTCAATGCGTACATTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013324.4-507s1c1
Sequence:CCGGCCTTCGGGAATCTGGCTGGTACTCGAGTACCAGCCAGATTCCCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_013324.4-776s1c1
Sequence:CCGGCCTGCACTGCTGATACCCGAACTCGAGTTCGGGTATCAGCAGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000056695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013324.4-480s1c1
Sequence:CCGGGCTGTGCATAGCCAAGACCTTCTCGAGAAGGTCTTGGCTATGCACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009895
CISH MISSION shRNA Bacterial Glycerol Stock
cytokine inducible SH2-containing protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-995s1c1
Sequence:CCGGACATCTGTGTCGGCTAGTCATCTCGAGATGACTAGCCGACACAGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-533s1c1
Sequence:CCGGCATAGCCAAGACGTTCTCCTACTCGAGTAGGAGAACGTCTTGGCTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-669s1c1
Sequence:CCGGCTGTTCACACTGTCAGTCAAACTCGAGTTTGACTGACAGTGTGAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-482s1c1
Sequence:CCGGCCAGGCAGAGAATGAACCGAACTCGAGTTCGGTTCATTCTCTGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-875s1c1
Sequence:CCGGCCTGCCTATGTCTAAGCAAGACTCGAGTCTTGCTTAGACATAGGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009895
CISH MISSION shRNA shRNA Plasmid DNA
cytokine inducible SH2-containing protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-995s1c1
Sequence:CCGGACATCTGTGTCGGCTAGTCATCTCGAGATGACTAGCCGACACAGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-533s1c1
Sequence:CCGGCATAGCCAAGACGTTCTCCTACTCGAGTAGGAGAACGTCTTGGCTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-669s1c1
Sequence:CCGGCTGTTCACACTGTCAGTCAAACTCGAGTTTGACTGACAGTGTGAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-482s1c1
Sequence:CCGGCCAGGCAGAGAATGAACCGAACTCGAGTTCGGTTCATTCTCTGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000055360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-875s1c1
Sequence:CCGGCCTGCCTATGTCTAAGCAAGACTCGAGTCTTGCTTAGACATAGGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009895
CISH MISSION shRNA Lentiviral Transduction Particles
cytokine inducible SH2-containing protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055361    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-995s1c1
Sequence:CCGGACATCTGTGTCGGCTAGTCATCTCGAGATGACTAGCCGACACAGATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-533s1c1
Sequence:CCGGCATAGCCAAGACGTTCTCCTACTCGAGTAGGAGAACGTCTTGGCTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-669s1c1
Sequence:CCGGCTGTTCACACTGTCAGTCAAACTCGAGTTTGACTGACAGTGTGAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-482s1c1
Sequence:CCGGCCAGGCAGAGAATGAACCGAACTCGAGTTCGGTTCATTCTCTGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000055360    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009895.2-875s1c1
Sequence:CCGGCCTGCCTATGTCTAAGCAAGACTCGAGTCTTGCTTAGACATAGGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)