EMAIL THIS PAGE TO A FRIEND

CIT

citron (rho-interacting, serine/threonine kinase 21)

Synonyms: CRIK STK21
UniProtKB ID: O14578, Q2M5E1, Q6XUH8, Q86UQ9, Q9UPZ7
Gene ID:
Human(11113) Summary: This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
Mouse(12704) citron
Rat(83620) citron (rho-interacting, serine/threonine kinase 21)
chicken(416984) citron (rho-interacting, serine/threonine kinase 21)
domestic cat(101094297) citron (rho-interacting, serine/threonine kinase 21)
cow(786852) citron (rho-interacting, serine/threonine kinase 21)
Horse(100050621) citron (rho-interacting, serine/threonine kinase 21)
dog(100683247) citron (rho-interacting, serine/threonine kinase 21)
domestic guinea pig(100731607) citron (rho-interacting, serine/threonine kinase 21)
naked mole-rat(101704993) citron (rho-interacting, serine/threonine kinase 21)
sheep(101107309) citron (rho-interacting, serine/threonine kinase 21)
Domestic Rabbit(100348177) citron (rho-interacting, serine/threonine kinase 21)
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007174 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007708 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007708 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007708 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007174 Rosetta Predictions human pricing
NM_001029911 Rosetta Predictions rat pricing
NM_007708 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224173 predicted 2262
2 SASI_Hs01_00224174 predicted 1802
3 SASI_Hs01_00224175 predicted 5572
4 SASI_Hs01_00224176 predicted 3217
5 SASI_Hs01_00224177 predicted 1787
6 SASI_Hs02_00343117 predicted 3699
7 SASI_Hs01_00224178 predicted 5711
8 SASI_Hs01_00224180 predicted 4229
9 SASI_Hs01_00224181 predicted 2995
10 SASI_Hs01_00224182 predicted 4120
11 SASI_Hs01_00224179 predicted 5271
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203476 predicted 4424
2 SASI_Rn01_00085056 predicted 5844
3 SASI_Rn01_00085057 predicted 879
4 SASI_Rn01_00085059 predicted 4257
5 SASI_Rn01_00085060 predicted 3132
6 SASI_Rn01_00085061 predicted 336
7 SASI_Rn01_00085062 predicted 3463
8 SASI_Rn02_00203477 predicted 3622
9 SASI_Rn02_00203478 predicted 4245
10 SASI_Rn01_00085063 predicted 395
11 SASI_Rn01_00085058 predicted 4225
12 SASI_Rn01_00085064 predicted 2502
13 SASI_Rn01_00085065 predicted 5023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007708 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00129297 predicted 3194
2 SASI_Mm01_00129298 predicted 5028
3 SASI_Mm01_00129299 predicted 6452
4 SASI_Mm01_00129301 predicted 3012
5 SASI_Mm02_00312274 predicted 1752
6 SASI_Mm01_00129302 predicted 3734
7 SASI_Mm01_00129303 predicted 4232
8 SASI_Mm01_00129304 predicted 2248
9 SASI_Mm01_00129305 predicted 5951
10 SASI_Mm01_00129306 predicted 3102
11 SASI_Mm01_00129300 predicted 6427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007174
VALIDATED
CIT MISSION shRNA Bacterial Glycerol Stock
citron (rho-interacting, serine/threonine kinase 21)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007174.1-7559s1c1
Sequence:CCGGCCCTCCTATTAGAGTACGAAACTCGAGTTTCGTACTCTAATAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007174.1-285s1c1
Sequence:CCGGCGGAAGTATTCCGACACCATACTCGAGTATGGTGTCGGAATACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007174.1-3603s1c1
Sequence:CCGGGCTGATCTACTGAAGACAGAACTCGAGTTCTGTCTTCAGTAGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007174.1-5709s1c1
Sequence:CCGGGCGTCCTCATACCAGGATAAACTCGAGTTTATCCTGGTATGAGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007174.1-2412s1c1
Sequence:CCGGGCCAATAAACTTGCAGCAAATCTCGAGATTTGCTGCAAGTTTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007174.1-4218s1c1
Sequence:CCGGGCATCCAAATGTCTCGAATGTCTCGAGACATTCGAGACATTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007174.1-5683s1c1
Sequence:CCGGCCATTTCCTCAGGAGCGATTTCTCGAGAAATCGCTCCTGAGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007174.1-3603s21c1
Sequence:CCGGGCTGATCTACTGAAGACAGAACTCGAGTTCTGTCTTCAGTAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007174.1-7559s21c1
Sequence:CCGGCCCTCCTATTAGAGTACGAAACTCGAGTTTCGTACTCTAATAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007174.1-285s21c1
Sequence:CCGGCGGAAGTATTCCGACACCATACTCGAGTATGGTGTCGGAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007174.1-2412s21c1
Sequence:CCGGGCCAATAAACTTGCAGCAAATCTCGAGATTTGCTGCAAGTTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_007174.1-5709s21c1
Sequence:CCGGGCGTCCTCATACCAGGATAAACTCGAGTTTATCCTGGTATGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007174
VALIDATED
CIT MISSION shRNA shRNA Plasmid DNA
citron (rho-interacting, serine/threonine kinase 21)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007174.1-7559s1c1
Sequence:CCGGCCCTCCTATTAGAGTACGAAACTCGAGTTTCGTACTCTAATAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007174.1-285s1c1
Sequence:CCGGCGGAAGTATTCCGACACCATACTCGAGTATGGTGTCGGAATACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007174.1-3603s1c1
Sequence:CCGGGCTGATCTACTGAAGACAGAACTCGAGTTCTGTCTTCAGTAGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007174.1-5709s1c1
Sequence:CCGGGCGTCCTCATACCAGGATAAACTCGAGTTTATCCTGGTATGAGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007174.1-2412s1c1
Sequence:CCGGGCCAATAAACTTGCAGCAAATCTCGAGATTTGCTGCAAGTTTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007174.1-4218s1c1
Sequence:CCGGGCATCCAAATGTCTCGAATGTCTCGAGACATTCGAGACATTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007174.1-5683s1c1
Sequence:CCGGCCATTTCCTCAGGAGCGATTTCTCGAGAAATCGCTCCTGAGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007174.1-3603s21c1
Sequence:CCGGGCTGATCTACTGAAGACAGAACTCGAGTTCTGTCTTCAGTAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007174.1-7559s21c1
Sequence:CCGGCCCTCCTATTAGAGTACGAAACTCGAGTTTCGTACTCTAATAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007174.1-285s21c1
Sequence:CCGGCGGAAGTATTCCGACACCATACTCGAGTATGGTGTCGGAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007174.1-2412s21c1
Sequence:CCGGGCCAATAAACTTGCAGCAAATCTCGAGATTTGCTGCAAGTTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_007174.1-5709s21c1
Sequence:CCGGGCGTCCTCATACCAGGATAAACTCGAGTTTATCCTGGTATGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007174
VALIDATED
CIT MISSION shRNA Lentiviral Transduction Particles
citron (rho-interacting, serine/threonine kinase 21)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006313    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007174.1-7559s1c1
Sequence:CCGGCCCTCCTATTAGAGTACGAAACTCGAGTTTCGTACTCTAATAGGAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007174.1-285s1c1
Sequence:CCGGCGGAAGTATTCCGACACCATACTCGAGTATGGTGTCGGAATACTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007174.1-3603s1c1
Sequence:CCGGGCTGATCTACTGAAGACAGAACTCGAGTTCTGTCTTCAGTAGATCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_007174.1-5709s1c1
Sequence:CCGGGCGTCCTCATACCAGGATAAACTCGAGTTTATCCTGGTATGAGGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006314    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_007174.1-2412s1c1
Sequence:CCGGGCCAATAAACTTGCAGCAAATCTCGAGATTTGCTGCAAGTTTATTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197232    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007174.1-4218s1c1
Sequence:CCGGGCATCCAAATGTCTCGAATGTCTCGAGACATTCGAGACATTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195505    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007174.1-5683s1c1
Sequence:CCGGCCATTTCCTCAGGAGCGATTTCTCGAGAAATCGCTCCTGAGGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007174.1-3603s21c1
Sequence:CCGGGCTGATCTACTGAAGACAGAACTCGAGTTCTGTCTTCAGTAGATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277747    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_007174.1-7559s21c1
Sequence:CCGGCCCTCCTATTAGAGTACGAAACTCGAGTTTCGTACTCTAATAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007174.1-285s21c1
Sequence:CCGGCGGAAGTATTCCGACACCATACTCGAGTATGGTGTCGGAATACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_007174.1-2412s21c1
Sequence:CCGGGCCAATAAACTTGCAGCAAATCTCGAGATTTGCTGCAAGTTTATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277814    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_007174.1-5709s21c1
Sequence:CCGGGCGTCCTCATACCAGGATAAACTCGAGTTTATCCTGGTATGAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007708
VALIDATED
CIT MISSION shRNA Bacterial Glycerol Stock
citron (rho-interacting, serine/threonine kinase 21)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007708.1-6394s1c1
Sequence:CCGGGCCCGAGCATATCTGGAAATTCTCGAGAATTTCCAGATATGCTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007708.1-2892s1c1
Sequence:CCGGCCAGACAAAGTCCGAACAGATCTCGAGATCTGTTCGGACTTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007708.1-5531s1c1
Sequence:CCGGCCGATGCTAAATTACTTGGAACTCGAGTTCCAAGTAATTTAGCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000022751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007708.1-1459s1c1
Sequence:CCGGGCCGCTAAGATGAATTCAAATCTCGAGATTTGAATTCATCTTAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-6195s21c1
Sequence:CCGGTGCTGTGCTTCCACGAATTTGCTCGAGCAAATTCGTGGAAGCACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-946s21c1
Sequence:CCGGCCAGAAGTATTCCGACACCATCTCGAGATGGTGTCGGAATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-5506s21c1
Sequence:CCGGGGCCGAAGCCGATGCTAAATTCTCGAGAATTTAGCATCGGCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-6454s21c1
Sequence:CCGGCTCATACCAGGACAAGTTAAGCTCGAGCTTAACTTGTCCTGGTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-5922s21c1
Sequence:CCGGTCGTCATCCTCCGCTACAATGCTCGAGCATTGTAGCGGAGGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-1442s21c1
Sequence:CCGGGCCGCTAAGATGAATTCAAATCTCGAGATTTGAATTCATCTTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-4870s21c1
Sequence:CCGGCAACATCCCTCACCGGTTTAACTCGAGTTAAACCGGTGAGGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007708
VALIDATED
CIT MISSION shRNA shRNA Plasmid DNA
citron (rho-interacting, serine/threonine kinase 21)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007708.1-6394s1c1
Sequence:CCGGGCCCGAGCATATCTGGAAATTCTCGAGAATTTCCAGATATGCTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007708.1-2892s1c1
Sequence:CCGGCCAGACAAAGTCCGAACAGATCTCGAGATCTGTTCGGACTTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007708.1-5531s1c1
Sequence:CCGGCCGATGCTAAATTACTTGGAACTCGAGTTCCAAGTAATTTAGCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000022751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007708.1-1459s1c1
Sequence:CCGGGCCGCTAAGATGAATTCAAATCTCGAGATTTGAATTCATCTTAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-6195s21c1
Sequence:CCGGTGCTGTGCTTCCACGAATTTGCTCGAGCAAATTCGTGGAAGCACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-946s21c1
Sequence:CCGGCCAGAAGTATTCCGACACCATCTCGAGATGGTGTCGGAATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-5506s21c1
Sequence:CCGGGGCCGAAGCCGATGCTAAATTCTCGAGAATTTAGCATCGGCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-6454s21c1
Sequence:CCGGCTCATACCAGGACAAGTTAAGCTCGAGCTTAACTTGTCCTGGTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-5922s21c1
Sequence:CCGGTCGTCATCCTCCGCTACAATGCTCGAGCATTGTAGCGGAGGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-1442s21c1
Sequence:CCGGGCCGCTAAGATGAATTCAAATCTCGAGATTTGAATTCATCTTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-4870s21c1
Sequence:CCGGCAACATCCCTCACCGGTTTAACTCGAGTTAAACCGGTGAGGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007708
VALIDATED
CIT MISSION shRNA Lentiviral Transduction Particles
citron (rho-interacting, serine/threonine kinase 21)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022749    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007708.1-6394s1c1
Sequence:CCGGGCCCGAGCATATCTGGAAATTCTCGAGAATTTCCAGATATGCTCGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007708.1-2892s1c1
Sequence:CCGGCCAGACAAAGTCCGAACAGATCTCGAGATCTGTTCGGACTTTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007708.1-5531s1c1
Sequence:CCGGCCGATGCTAAATTACTTGGAACTCGAGTTCCAAGTAATTTAGCATCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000022751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007708.1-1459s1c1
Sequence:CCGGGCCGCTAAGATGAATTCAAATCTCGAGATTTGAATTCATCTTAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424293    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-6195s21c1
Sequence:CCGGTGCTGTGCTTCCACGAATTTGCTCGAGCAAATTCGTGGAAGCACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-946s21c1
Sequence:CCGGCCAGAAGTATTCCGACACCATCTCGAGATGGTGTCGGAATACTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378504    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-5506s21c1
Sequence:CCGGGGCCGAAGCCGATGCTAAATTCTCGAGAATTTAGCATCGGCTTCGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-6454s21c1
Sequence:CCGGCTCATACCAGGACAAGTTAAGCTCGAGCTTAACTTGTCCTGGTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-5922s21c1
Sequence:CCGGTCGTCATCCTCCGCTACAATGCTCGAGCATTGTAGCGGAGGATGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-1442s21c1
Sequence:CCGGGCCGCTAAGATGAATTCAAATCTCGAGATTTGAATTCATCTTAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007708.3-4870s21c1
Sequence:CCGGCAACATCCCTCACCGGTTTAACTCGAGTTAAACCGGTGAGGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks