EMAIL THIS PAGE TO A FRIEND

CITED1

Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1

59 Gene Product Result for
Synonyms: MSG1
UniProtKB ID: Q99966, B5BU50, B5BUI2
Gene ID:
Human(4435) Summary: This gene encodes a member of the CREB-binding protein/p300-interacting transactivator with Asp/Glu-rich C-terminal domain (CITED) family of proteins. The encoded protein, also known as melanocyte-specific gene 1, may function as a transcriptional coactivator and may play a role in pigmentation of melanocytes. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2009]
Mouse(12705) Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1
Rat(64466) Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 1
dog(607904) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
cow(282182) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
domestic cat(101095798) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
sheep(101109515) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
naked mole-rat(101696640) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
domestic guinea pig(100722170) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100234 Anti-CITED1 (16-30) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100235 Anti-CITED1 (78-89) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2107892 Anti-CITED1 antibody produced in rabbit affinity isolated antibody bovine, rat, mouse, rabbit, canine, guinea pig, human
immunohistochemistry, western blot pricing
AV32705 Anti-CITED1 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, human, bovine, pig, canine, rat
immunohistochemistry, western blot pricing
HPA049051 Anti-CITED1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0004435M1 Monoclonal Anti-CITED1 antibody produced in mouse clone 6G8, purified immunoglobulin, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing
SAB1409324 Monoclonal Anti-CITED1 antibody produced in mouse clone 6C1, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB1409325 Monoclonal Anti-CITED1 antibody produced in mouse clone 6E12, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB1409326 Monoclonal Anti-CITED1 antibody produced in mouse clone 6C8, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB1409327 Monoclonal Anti-CITED1 antibody produced in mouse clone 2H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404082 Monoclonal Anti-CITED1, (C-terminal) antibody produced in mouse clone 5H6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004143 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004143 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004143 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004143 Rosetta Predictions human pricing
NM_172055 Rosetta Predictions rat pricing
NM_007709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004143 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00176300 predicted 581
2 SASI_Hs01_00176301 predicted 601
3 SASI_Hs01_00176302 predicted 703
4 SASI_Hs01_00176303 predicted 786
5 SASI_Hs01_00176304 predicted 624
6 SASI_Hs01_00176305 predicted 806
7 SASI_Hs02_00336994 predicted 530
8 SASI_Hs01_00176306 predicted 615
9 SASI_Hs01_00176307 predicted 617
10 SASI_Hs01_00176308 predicted 570
11 SASI_Hs01_00176309 predicted 732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172055 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108786 predicted 501
2 SASI_Rn01_00108787 predicted 503
3 SASI_Rn02_00269156 predicted 229
4 SASI_Rn02_00269157 predicted 274
5 SASI_Rn02_00269158 predicted 440
6 SASI_Rn02_00269159 predicted 314
7 SASI_Rn02_00269160 predicted 436
8 SASI_Rn02_00269161 predicted 427
9 SASI_Rn02_00269162 predicted 276
10 SASI_Rn02_00269163 predicted 309
11 SASI_Rn01_00108788 predicted 161
12 SASI_Rn01_00108789 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00159070 predicted 457
2 SASI_Mm01_00159071 predicted 414
3 SASI_Mm01_00159072 predicted 338
4 SASI_Mm01_00159073 predicted 387
5 SASI_Mm01_00159074 predicted 709
6 SASI_Mm02_00312275 predicted 626
7 SASI_Mm01_00159075 predicted 428
8 SASI_Mm01_00159076 predicted 583
9 SASI_Mm01_00159077 predicted 513
10 SASI_Mm01_00159079 predicted 453
11 SASI_Mm01_00159078 predicted 689
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004143
VALIDATED
CITED1 MISSION shRNA Bacterial Glycerol Stock
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-926s21c1
Sequence:CCGGGCAGAATCACTCTCTCCTTCTCTCGAGAGAAGGAGAGAGTGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-957s21c1
Sequence:CCGGAGAGCCCTGCTATCATCGATTCTCGAGAATCGATGATAGCAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-820s21c1
Sequence:CCGGGCAGAAACTTAATAGCCAGTACTCGAGTACTGGCTATTAAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-806s21c1
Sequence:CCGGGCTAGTATGCAGCTGCAGAAACTCGAGTTTCTGCAGCTGCATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004143.2-806s1c1
Sequence:CCGGGCTAGTATGCAGCTGCAGAAACTCGAGTTTCTGCAGCTGCATACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004143.2-926s1c1
Sequence:CCGGGCAGAATCACTCTCTCCTTCTCTCGAGAGAAGGAGAGAGTGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004143.2-957s1c1
Sequence:CCGGAGAGCCCTGCTATCATCGATTCTCGAGAATCGATGATAGCAGGGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004143
VALIDATED
CITED1 MISSION shRNA shRNA Plasmid DNA
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-926s21c1
Sequence:CCGGGCAGAATCACTCTCTCCTTCTCTCGAGAGAAGGAGAGAGTGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-957s21c1
Sequence:CCGGAGAGCCCTGCTATCATCGATTCTCGAGAATCGATGATAGCAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-820s21c1
Sequence:CCGGGCAGAAACTTAATAGCCAGTACTCGAGTACTGGCTATTAAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-806s21c1
Sequence:CCGGGCTAGTATGCAGCTGCAGAAACTCGAGTTTCTGCAGCTGCATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004143.2-806s1c1
Sequence:CCGGGCTAGTATGCAGCTGCAGAAACTCGAGTTTCTGCAGCTGCATACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004143.2-926s1c1
Sequence:CCGGGCAGAATCACTCTCTCCTTCTCTCGAGAGAAGGAGAGAGTGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004143.2-957s1c1
Sequence:CCGGAGAGCCCTGCTATCATCGATTCTCGAGAATCGATGATAGCAGGGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004143
VALIDATED
CITED1 MISSION shRNA Lentiviral Transduction Particles
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297126    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-926s21c1
Sequence:CCGGGCAGAATCACTCTCTCCTTCTCTCGAGAGAAGGAGAGAGTGATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-957s21c1
Sequence:CCGGAGAGCCCTGCTATCATCGATTCTCGAGAATCGATGATAGCAGGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-820s21c1
Sequence:CCGGGCAGAAACTTAATAGCCAGTACTCGAGTACTGGCTATTAAGTTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278024    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004143.2-806s21c1
Sequence:CCGGGCTAGTATGCAGCTGCAGAAACTCGAGTTTCTGCAGCTGCATACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004143.2-806s1c1
Sequence:CCGGGCTAGTATGCAGCTGCAGAAACTCGAGTTTCTGCAGCTGCATACTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004143.2-926s1c1
Sequence:CCGGGCAGAATCACTCTCTCCTTCTCTCGAGAGAAGGAGAGAGTGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004143.2-957s1c1
Sequence:CCGGAGAGCCCTGCTATCATCGATTCTCGAGAATCGATGATAGCAGGGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007709
VALIDATED
CITED1 MISSION shRNA Bacterial Glycerol Stock
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-639s1c1
Sequence:CCGGTCAGAAGCTTAATAGCCAGTACTCGAGTACTGGCTATTAAGCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-629s1c1
Sequence:CCGGGCATGCAGCTTCAGAAGCTTACTCGAGTAAGCTTCTGAAGCTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007709.3-432s1c1
Sequence:CCGGCTACTCCAACCTTGGAGTGAACTCGAGTTCACTCCAAGGTTGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-804s1c1
Sequence:CCGGCCCTGCTCTCATTGATTCTGACTCGAGTCAGAATCAATGAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-534s1c1
Sequence:CCGGCTCTGGATCGACATCTCCAATCTCGAGATTGGAGATGTCGATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007709
VALIDATED
CITED1 MISSION shRNA shRNA Plasmid DNA
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-639s1c1
Sequence:CCGGTCAGAAGCTTAATAGCCAGTACTCGAGTACTGGCTATTAAGCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-629s1c1
Sequence:CCGGGCATGCAGCTTCAGAAGCTTACTCGAGTAAGCTTCTGAAGCTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007709.3-432s1c1
Sequence:CCGGCTACTCCAACCTTGGAGTGAACTCGAGTTCACTCCAAGGTTGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-804s1c1
Sequence:CCGGCCCTGCTCTCATTGATTCTGACTCGAGTCAGAATCAATGAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-534s1c1
Sequence:CCGGCTCTGGATCGACATCTCCAATCTCGAGATTGGAGATGTCGATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007709
VALIDATED
CITED1 MISSION shRNA Lentiviral Transduction Particles
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095237    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-639s1c1
Sequence:CCGGTCAGAAGCTTAATAGCCAGTACTCGAGTACTGGCTATTAAGCTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-629s1c1
Sequence:CCGGGCATGCAGCTTCAGAAGCTTACTCGAGTAAGCTTCTGAAGCTGCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007709.3-432s1c1
Sequence:CCGGCTACTCCAACCTTGGAGTGAACTCGAGTTCACTCCAAGGTTGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-804s1c1
Sequence:CCGGCCCTGCTCTCATTGATTCTGACTCGAGTCAGAATCAATGAGAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_007709.3-534s1c1
Sequence:CCGGCTCTGGATCGACATCTCCAATCTCGAGATTGGAGATGTCGATCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks