EMAIL THIS PAGE TO A FRIEND

CITED2

Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2

110 Gene Product Result for
Synonyms: ASD8 MRG-1 MRG1 P35SRJ VSD2
UniProtKB ID: Q99967, O95426, Q5VTF4
Gene ID:
Human(10370) Summary: The protein encoded by this gene inhibits transactivation of HIF1A-induced genes by competing with binding of hypoxia-inducible factor 1-alpha to p300-CH1. Mutations in this gene are a cause of cardiac septal defects. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
Mouse(17684) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Rat(114490) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
domestic guinea pig(100718842) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
sheep(101123049) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
sheep(100135454) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Zebrafish(450024) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
cow(521378) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
dog(484010) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
chicken(395399) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV35789 Anti-CITED2 (AB1) antibody produced in rabbit affinity isolated antibody bovine, human, mouse, guinea pig, rat
western blot pricing
AV38735 Anti-CITED2 (AB2) antibody produced in rabbit affinity isolated antibody mouse, human, rat, bovine, guinea pig
western blot pricing
SAB1408753 Anti-CITED2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB3501021 Anti-CITED2 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006079 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006079 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006079 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049321 MISSION® esiRNA esiRNA human CITED2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006079 Rosetta Predictions human pricing
NM_053698 Rosetta Predictions rat pricing
NM_010828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006079 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00206124 predicted 391
2 SASI_Hs01_00206125 predicted 515
3 SASI_Hs01_00206126 predicted 413
4 SASI_Hs01_00206127 predicted 243
5 SASI_Hs01_00206128 predicted 390
6 SASI_Hs01_00206129 predicted 421
7 SASI_Hs01_00206130 predicted 510
8 SASI_Hs01_00206131 predicted 406
9 SASI_Hs01_00206132 predicted 377
10 SASI_Hs01_00206133 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099439 predicted 379
2 SASI_Rn01_00099440 predicted 381
3 SASI_Rn01_00099441 predicted 498
4 SASI_Rn01_00099442 predicted 383
5 SASI_Rn02_00266464 predicted 278
6 SASI_Rn01_00099444 predicted 405
7 SASI_Rn01_00099445 predicted 375
8 SASI_Rn01_00099446 predicted 495
9 SASI_Rn01_00099447 predicted 403
10 SASI_Rn02_00266465 predicted 294
11 SASI_Rn01_00099443 predicted 503
12 SASI_Rn01_00099448 predicted 404
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089417 predicted 366
2 SASI_Mm01_00089418 predicted 482
3 SASI_Mm01_00089419 predicted 394
4 SASI_Mm01_00089420 predicted 226
5 SASI_Mm01_00089421 predicted 365
6 SASI_Mm01_00089422 predicted 489
7 SASI_Mm01_00089423 predicted 394
8 SASI_Mm01_00089424 predicted 387
9 SASI_Mm01_00089425 predicted 311
10 SASI_Mm02_00319450 predicted 227
11 SASI_Mm01_00089416 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006079
VALIDATED
CITED2 MISSION shRNA Bacterial Glycerol Stock
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-843s1c1
Sequence:CCGGCCAATGTCATAGACACTGATTCTCGAGAATCAGTGTCTATGACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-871s1c1
Sequence:CCGGCGAGGAAGTTCTTATGTCCTTCTCGAGAAGGACATAAGAACTTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006079.2-627s1c1
Sequence:CCGGGCCACCAGATGAACGGGACAACTCGAGTTGTCCCGTTCATCTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-475s1c1
Sequence:CCGGGTTTAACAACTCCCAGTTCATCTCGAGATGAACTGGGAGTTGTTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-592s1c1
Sequence:CCGGCAACCACTACATGCCGGATTTCTCGAGAAATCCGGCATGTAGTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-674s21c1
Sequence:CCGGCACCAGATGAACGGGACAAACCTCGAGGTTTGTCCCGTTCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006079.3-1547s21c1
Sequence:CCGGCATTTGAGTACAGACTAATTTCTCGAGAAATTAGTCTGTACTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-637s21c1
Sequence:CCGGCAACCACTACATGCCGGATTTCTCGAGAAATCCGGCATGTAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-910s21c1
Sequence:CCGGCATCGACGAGGAAGTTCTTATCTCGAGATAAGAACTTCCTCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-1049s21c1
Sequence:CCGGAGCTGTTGACTCGATCGAAACCTCGAGGTTTCGATCGAGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006079
VALIDATED
CITED2 MISSION shRNA shRNA Plasmid DNA
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-843s1c1
Sequence:CCGGCCAATGTCATAGACACTGATTCTCGAGAATCAGTGTCTATGACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-871s1c1
Sequence:CCGGCGAGGAAGTTCTTATGTCCTTCTCGAGAAGGACATAAGAACTTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006079.2-627s1c1
Sequence:CCGGGCCACCAGATGAACGGGACAACTCGAGTTGTCCCGTTCATCTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-475s1c1
Sequence:CCGGGTTTAACAACTCCCAGTTCATCTCGAGATGAACTGGGAGTTGTTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-592s1c1
Sequence:CCGGCAACCACTACATGCCGGATTTCTCGAGAAATCCGGCATGTAGTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-674s21c1
Sequence:CCGGCACCAGATGAACGGGACAAACCTCGAGGTTTGTCCCGTTCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006079.3-1547s21c1
Sequence:CCGGCATTTGAGTACAGACTAATTTCTCGAGAAATTAGTCTGTACTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-637s21c1
Sequence:CCGGCAACCACTACATGCCGGATTTCTCGAGAAATCCGGCATGTAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-910s21c1
Sequence:CCGGCATCGACGAGGAAGTTCTTATCTCGAGATAAGAACTTCCTCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-1049s21c1
Sequence:CCGGAGCTGTTGACTCGATCGAAACCTCGAGGTTTCGATCGAGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006079
VALIDATED
CITED2 MISSION shRNA Lentiviral Transduction Particles
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-843s1c1
Sequence:CCGGCCAATGTCATAGACACTGATTCTCGAGAATCAGTGTCTATGACATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-871s1c1
Sequence:CCGGCGAGGAAGTTCTTATGTCCTTCTCGAGAAGGACATAAGAACTTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015657    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006079.2-627s1c1
Sequence:CCGGGCCACCAGATGAACGGGACAACTCGAGTTGTCCCGTTCATCTGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-475s1c1
Sequence:CCGGGTTTAACAACTCCCAGTTCATCTCGAGATGAACTGGGAGTTGTTAAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006079.2-592s1c1
Sequence:CCGGCAACCACTACATGCCGGATTTCTCGAGAAATCCGGCATGTAGTGGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234670    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-674s21c1
Sequence:CCGGCACCAGATGAACGGGACAAACCTCGAGGTTTGTCCCGTTCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234672    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006079.3-1547s21c1
Sequence:CCGGCATTTGAGTACAGACTAATTTCTCGAGAAATTAGTCTGTACTCAAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-637s21c1
Sequence:CCGGCAACCACTACATGCCGGATTTCTCGAGAAATCCGGCATGTAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-910s21c1
Sequence:CCGGCATCGACGAGGAAGTTCTTATCTCGAGATAAGAACTTCCTCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006079.3-1049s21c1
Sequence:CCGGAGCTGTTGACTCGATCGAAACCTCGAGGTTTCGATCGAGTCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010828
VALIDATED
CITED2 MISSION shRNA Bacterial Glycerol Stock
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-738s1c1
Sequence:CCGGCCTTAGTGATAGAAATGGGTTCTCGAGAACCCATTTCTATCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-707s1c1
Sequence:CCGGACTGATTTCATCGACGAGGAACTCGAGTTCCTCGTCGATGAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-355s1c1
Sequence:CCGGGCACGCCTTCAACGCCCTCATCTCGAGATGAGGGCGTTGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010828.1-571s1c1
Sequence:CCGGGAAGCTCAACAACCAGTATTTCTCGAGAAATACTGGTTGTTGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-649s1c1
Sequence:CCGGCCACCAGATGAACGGGACAAACTCGAGTTTGTCCCGTTCATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010828.3-1148s21c1
Sequence:CCGGCATTCCCTTAGACGCAGTATCCTCGAGGATACTGCGTCTAAGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.3-670s21c1
Sequence:CCGGCACCAGATGAACGGGACAAACCTCGAGGTTTGTCCCGTTCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010828.2-1021s21c1
Sequence:CCGGGTCAGCTGTTGACTCGGTTAACTCGAGTTAACCGAGTCAACAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.2-615s21c1
Sequence:CCGGCAACCACTACATGCCGGATTTCTCGAGAAATCCGGCATGTAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010828.2-1499s21c1
Sequence:CCGGATCTTTGAAGGGCAGATATTACTCGAGTAATATCTGCCCTTCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.2-572s21c1
Sequence:GTACCGGAGAAGCTCAACAACCAGTATTCTCGAGAATACTGGTTGTTGAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.2-885s21c1
Sequence:CCGGCATCGACGAGGAAGTGCTTATCTCGAGATAAGCACTTCCTCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010828
VALIDATED
CITED2 MISSION shRNA shRNA Plasmid DNA
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-738s1c1
Sequence:CCGGCCTTAGTGATAGAAATGGGTTCTCGAGAACCCATTTCTATCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-707s1c1
Sequence:CCGGACTGATTTCATCGACGAGGAACTCGAGTTCCTCGTCGATGAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-355s1c1
Sequence:CCGGGCACGCCTTCAACGCCCTCATCTCGAGATGAGGGCGTTGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010828.1-571s1c1
Sequence:CCGGGAAGCTCAACAACCAGTATTTCTCGAGAAATACTGGTTGTTGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-649s1c1
Sequence:CCGGCCACCAGATGAACGGGACAAACTCGAGTTTGTCCCGTTCATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010828.3-1148s21c1
Sequence:CCGGCATTCCCTTAGACGCAGTATCCTCGAGGATACTGCGTCTAAGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.3-670s21c1
Sequence:CCGGCACCAGATGAACGGGACAAACCTCGAGGTTTGTCCCGTTCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010828.2-1021s21c1
Sequence:CCGGGTCAGCTGTTGACTCGGTTAACTCGAGTTAACCGAGTCAACAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.2-615s21c1
Sequence:CCGGCAACCACTACATGCCGGATTTCTCGAGAAATCCGGCATGTAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010828.2-1499s21c1
Sequence:CCGGATCTTTGAAGGGCAGATATTACTCGAGTAATATCTGCCCTTCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.2-572s21c1
Sequence:GTACCGGAGAAGCTCAACAACCAGTATTCTCGAGAATACTGGTTGTTGAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.2-885s21c1
Sequence:CCGGCATCGACGAGGAAGTGCTTATCTCGAGATAAGCACTTCCTCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010828
VALIDATED
CITED2 MISSION shRNA Lentiviral Transduction Particles
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000055103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-738s1c1
Sequence:CCGGCCTTAGTGATAGAAATGGGTTCTCGAGAACCCATTTCTATCACTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-707s1c1
Sequence:CCGGACTGATTTCATCGACGAGGAACTCGAGTTCCTCGTCGATGAAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-355s1c1
Sequence:CCGGGCACGCCTTCAACGCCCTCATCTCGAGATGAGGGCGTTGAAGGCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010828.1-571s1c1
Sequence:CCGGGAAGCTCAACAACCAGTATTTCTCGAGAAATACTGGTTGTTGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010828.1-649s1c1
Sequence:CCGGCCACCAGATGAACGGGACAAACTCGAGTTTGTCCCGTTCATCTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360507    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010828.3-1148s21c1
Sequence:CCGGCATTCCCTTAGACGCAGTATCCTCGAGGATACTGCGTCTAAGGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.3-670s21c1
Sequence:CCGGCACCAGATGAACGGGACAAACCTCGAGGTTTGTCCCGTTCATCTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257264    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010828.2-1021s21c1
Sequence:CCGGGTCAGCTGTTGACTCGGTTAACTCGAGTTAACCGAGTCAACAGCTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.2-615s21c1
Sequence:CCGGCAACCACTACATGCCGGATTTCTCGAGAAATCCGGCATGTAGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234123    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010828.2-1499s21c1
Sequence:CCGGATCTTTGAAGGGCAGATATTACTCGAGTAATATCTGCCCTTCAAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.2-572s21c1
Sequence:GTACCGGAGAAGCTCAACAACCAGTATTCTCGAGAATACTGGTTGTTGAGCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010828.2-885s21c1
Sequence:CCGGCATCGACGAGGAAGTGCTTATCTCGAGATAAGCACTTCCTCGTCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks