EMAIL THIS PAGE TO A FRIEND

CITED4

Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4

85 Gene Product Result for
UniProtKB ID: Q96RK1
Gene ID:
Human(163732) Summary: The protein encoded by this intronless gene belongs to the CITED family of transcriptional coactivators that bind to several proteins, including CREB-binding protein (CBP) and p300, via a conserved 32 aa C-terminal motif, and regulate gene transcription. This protein also interacts with transcription factor AP2 (TFAP2), and thus may function as a co-activator for TFAP2. Hypermethylation and transcriptional downregulation of this gene has been observed in oligodendroglial tumors with deletions of chromosomal arms 1p and 19q, and associated with longer recurrence-free and overall survival of patients with oligodendroglial tumors. [provided by RefSeq, Aug 2011]
Mouse(56222) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
Rat(114491) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
chicken(395465) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
cow(504742) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
sheep(101122913) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
domestic guinea pig(100717138) Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_133467 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_133467 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_133467 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_133467 Rosetta Predictions human pricing
NM_053699 Rosetta Predictions rat pricing
NM_019563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133467 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00059088 predicted 1002
2 SASI_Hs01_00059089 predicted 1013
3 SASI_Hs01_00059090 predicted 1019
4 SASI_Hs01_00059091 predicted 1034
5 SASI_Hs01_00059092 predicted 998
6 SASI_Hs01_00059093 predicted 1030
7 SASI_Hs01_00059094 predicted 1014
8 SASI_Hs01_00059095 predicted 1014
9 SASI_Hs01_00059096 predicted 985
10 SASI_Hs01_00059097 predicted 948
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053699 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00060350 predicted 227
2 SASI_Rn01_00060351 predicted 220
3 SASI_Rn01_00060352 predicted 230
4 SASI_Rn01_00060353 predicted 284
5 SASI_Rn01_00060354 predicted 230
6 SASI_Rn01_00060355 predicted 281
7 SASI_Rn01_00060356 predicted 725
8 SASI_Rn01_00060357 predicted 605
9 SASI_Rn01_00060358 predicted 664
10 SASI_Rn01_00060359 predicted 727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165368 predicted 940
2 SASI_Mm01_00165371 predicted 995
3 SASI_Mm02_00324599 predicted 964
4 SASI_Mm01_00165372 predicted 261
5 SASI_Mm01_00165373 predicted 246
6 SASI_Mm02_00324600 predicted 816
7 SASI_Mm01_00165374 predicted 994
8 SASI_Mm01_00165376 predicted 980
9 SASI_Mm02_00324601 predicted 874
10 SASI_Mm02_00324602 predicted 955
11 SASI_Mm01_00165369 predicted 944
12 SASI_Mm01_00165370 predicted 797
13 SASI_Mm01_00165375 predicted 879
14 SASI_Mm01_00165377 predicted 849
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019563
CITED4 MISSION shRNA Bacterial Glycerol Stock
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019563.2-1017s21c1
Sequence:CCGGTTGGATTCTGTGCCCTCTTTCCTCGAGGAAAGAGGGCACAGAATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019563.2-1049s21c1
Sequence:CCGGCCCAATCTGAGCCATTACAGGCTCGAGCCTGTAATGGCTCAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019563.2-634s21c1
Sequence:CCGGACCGAGCTCATCGACGAAGAGCTCGAGCTCTTCGTCGATGAGCTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-693s1c1
Sequence:CCGGCCAGAGCGAGTTCGATTGCTTCTCGAGAAGCAATCGAACTCGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-699s1c1
Sequence:CCGGCGAGTTCGATTGCTTCTCAGACTCGAGTCTGAGAAGCAATCGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019563.1-942s1c1
Sequence:CCGGGTCGTAATGGAGGGAACTGAACTCGAGTTCAGTTCCCTCCATTACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-289s1c1
Sequence:CCGGCGGACTCTGCAGCCATACGCACTCGAGTGCGTATGGCTGCAGAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-401s1c1
Sequence:CCGGCGCCGGTCTCTTTCCAGCCCTCTCGAGAGGGCTGGAAAGAGACCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019563
CITED4 MISSION shRNA shRNA Plasmid DNA
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019563.2-1017s21c1
Sequence:CCGGTTGGATTCTGTGCCCTCTTTCCTCGAGGAAAGAGGGCACAGAATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019563.2-1049s21c1
Sequence:CCGGCCCAATCTGAGCCATTACAGGCTCGAGCCTGTAATGGCTCAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019563.2-634s21c1
Sequence:CCGGACCGAGCTCATCGACGAAGAGCTCGAGCTCTTCGTCGATGAGCTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-693s1c1
Sequence:CCGGCCAGAGCGAGTTCGATTGCTTCTCGAGAAGCAATCGAACTCGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-699s1c1
Sequence:CCGGCGAGTTCGATTGCTTCTCAGACTCGAGTCTGAGAAGCAATCGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019563.1-942s1c1
Sequence:CCGGGTCGTAATGGAGGGAACTGAACTCGAGTTCAGTTCCCTCCATTACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-289s1c1
Sequence:CCGGCGGACTCTGCAGCCATACGCACTCGAGTGCGTATGGCTGCAGAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-401s1c1
Sequence:CCGGCGCCGGTCTCTTTCCAGCCCTCTCGAGAGGGCTGGAAAGAGACCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019563
CITED4 MISSION shRNA Lentiviral Transduction Particles
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430935    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019563.2-1017s21c1
Sequence:CCGGTTGGATTCTGTGCCCTCTTTCCTCGAGGAAAGAGGGCACAGAATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424498    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019563.2-1049s21c1
Sequence:CCGGCCCAATCTGAGCCATTACAGGCTCGAGCCTGTAATGGCTCAGATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019563.2-634s21c1
Sequence:CCGGACCGAGCTCATCGACGAAGAGCTCGAGCTCTTCGTCGATGAGCTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-693s1c1
Sequence:CCGGCCAGAGCGAGTTCGATTGCTTCTCGAGAAGCAATCGAACTCGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-699s1c1
Sequence:CCGGCGAGTTCGATTGCTTCTCAGACTCGAGTCTGAGAAGCAATCGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012363    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019563.1-942s1c1
Sequence:CCGGGTCGTAATGGAGGGAACTGAACTCGAGTTCAGTTCCCTCCATTACGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012367    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-289s1c1
Sequence:CCGGCGGACTCTGCAGCCATACGCACTCGAGTGCGTATGGCTGCAGAGTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012366    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019563.1-401s1c1
Sequence:CCGGCGCCGGTCTCTTTCCAGCCCTCTCGAGAGGGCTGGAAAGAGACCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133467
CITED4 MISSION shRNA Bacterial Glycerol Stock
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000423337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133467.2-1018s21c1
Sequence:CCGGAGCTTCAGCTTTCGGACTCTGCTCGAGCAGAGTCCGAAAGCTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-708s1c1
Sequence:CCGGCCAGAGCGAGTTCGACTGCTTCTCGAGAAGCAGTCGAACTCGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-717s1c1
Sequence:CCGGGTTCGACTGCTTCTCGGACTTCTCGAGAAGTCCGAGAAGCAGTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-609s1c1
Sequence:CCGGCGGCATGGACGCCGAACTCATCTCGAGATGAGTTCGGCGTCCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-618s1c1
Sequence:CCGGCGCCGAACTCATCGACGAGGACTCGAGTCCTCGTCGATGAGTTCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-426s1c1
Sequence:CCGGGCCGTCCTCCTTCCAGCCCTTCTCGAGAAGGGCTGGAAGGAGGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133467
CITED4 MISSION shRNA shRNA Plasmid DNA
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000423337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133467.2-1018s21c1
Sequence:CCGGAGCTTCAGCTTTCGGACTCTGCTCGAGCAGAGTCCGAAAGCTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-708s1c1
Sequence:CCGGCCAGAGCGAGTTCGACTGCTTCTCGAGAAGCAGTCGAACTCGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-717s1c1
Sequence:CCGGGTTCGACTGCTTCTCGGACTTCTCGAGAAGTCCGAGAAGCAGTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-609s1c1
Sequence:CCGGCGGCATGGACGCCGAACTCATCTCGAGATGAGTTCGGCGTCCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-618s1c1
Sequence:CCGGCGCCGAACTCATCGACGAGGACTCGAGTCCTCGTCGATGAGTTCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-426s1c1
Sequence:CCGGGCCGTCCTCCTTCCAGCCCTTCTCGAGAAGGGCTGGAAGGAGGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133467
CITED4 MISSION shRNA Lentiviral Transduction Particles
Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 4
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000423337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133467.2-1018s21c1
Sequence:CCGGAGCTTCAGCTTTCGGACTCTGCTCGAGCAGAGTCCGAAAGCTGAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-708s1c1
Sequence:CCGGCCAGAGCGAGTTCGACTGCTTCTCGAGAAGCAGTCGAACTCGCTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-717s1c1
Sequence:CCGGGTTCGACTGCTTCTCGGACTTCTCGAGAAGTCCGAGAAGCAGTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-609s1c1
Sequence:CCGGCGGCATGGACGCCGAACTCATCTCGAGATGAGTTCGGCGTCCATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-618s1c1
Sequence:CCGGCGCCGAACTCATCGACGAGGACTCGAGTCCTCGTCGATGAGTTCGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133467.2-426s1c1
Sequence:CCGGGCCGTCCTCCTTCCAGCCCTTCTCGAGAAGGGCTGGAAGGAGGACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks