EMAIL THIS PAGE TO A FRIEND

CIZ1

CDKN1A interacting zinc finger protein 1

53 Gene Product Result for
Synonyms: LSFR1 NP94 ZNF356
Gene ID:
Human(25792) Summary: The protein encoded by this gene is a zinc finger DNA binding protein that interacts with CIP1, part of a complex with cyclin E. The encoded protein may regulate the cellular localization of CIP1. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
Mouse(68379) CDKN1A interacting zinc finger protein 1
Rat(296639) CDKN1A interacting zinc finger protein 1
chicken(417216) CDKN1A interacting zinc finger protein 1
cow(531522) CDKN1A interacting zinc finger protein 1
domestic cat(101098999) CDKN1A interacting zinc finger protein 1
dog(480709) CDKN1A interacting zinc finger protein 1
domestic guinea pig(100717372) CDKN1A interacting zinc finger protein 1
naked mole-rat(101703022) CDKN1A interacting zinc finger protein 1
sheep(101109005) CDKN1A interacting zinc finger protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012127 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028412 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028412 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028412 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU124851 MISSION® esiRNA esiRNA human CIZ1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012127 Rosetta Predictions human pricing
NM_001106568 Rosetta Predictions rat pricing
NM_028412 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199454 predicted 1012
2 SASI_Hs01_00199455 predicted 1836
3 SASI_Hs01_00199456 predicted 1630
4 SASI_Hs01_00199457 predicted 2150
5 SASI_Hs01_00199458 predicted 788
6 SASI_Hs01_00199459 predicted 780
7 SASI_Hs01_00199460 predicted 1940
8 SASI_Hs01_00199461 predicted 1729
9 SASI_Hs01_00199462 predicted 1633
10 SASI_Hs02_00343675 predicted 989
11 SASI_Hs01_00199463 predicted 1846
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220238 predicted 2609
2 SASI_Rn02_00220239 predicted 2554
3 SASI_Rn02_00220240 predicted 1809
4 SASI_Rn02_00220241 predicted 2160
5 SASI_Rn02_00220242 predicted 2736
6 SASI_Rn02_00220243 predicted 1483
7 SASI_Rn02_00220244 predicted 2775
8 SASI_Rn02_00220245 predicted 2434
9 SASI_Rn02_00220246 predicted 2395
10 SASI_Rn02_00220247 predicted 2403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028412 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108480 predicted 2113
2 SASI_Mm01_00108481 predicted 766
3 SASI_Mm01_00108482 predicted 2337
4 SASI_Mm01_00108483 predicted 1842
5 SASI_Mm01_00108484 predicted 2307
6 SASI_Mm01_00108485 predicted 1891
7 SASI_Mm01_00108486 predicted 2072
8 SASI_Mm01_00108487 predicted 1400
9 SASI_Mm01_00108488 predicted 420
10 SASI_Mm02_00333806 predicted 1985
11 SASI_Mm01_00108489 predicted 2180
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012127
VALIDATED
CIZ1 MISSION shRNA Bacterial Glycerol Stock
CDKN1A interacting zinc finger protein 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012127.2-2267s1c1
Sequence:CCGGCGTTTGCAACCGCTACTTCAACTCGAGTTGAAGTAGCGGTTGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-632s1c1
Sequence:CCGGCACTCCAAATTTGCAACAGTTCTCGAGAACTGTTGCAAATTTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-781s1c1
Sequence:CCGGCCAATCGAAAGGATTCTTCTTCTCGAGAAGAAGAATCCTTTCGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-2445s1c1
Sequence:CCGGGAGGATGATGAGGATGAAGAACTCGAGTTCTTCATCCTCATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-1635s1c1
Sequence:CCGGCAAACACCAGTTGTGGTTCATCTCGAGATGAACCACAACTGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-1973s1c1
Sequence:CCGGCCTCCAGTTCTTCTGCTACATCTCGAGATGTAGCAGAAGAACTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-1736s1c1
Sequence:CCGGCCAAGTCAGCATGGAAGAGATCTCGAGATCTCTTCCATGCTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-2672s1c1
Sequence:CCGGCCACTTTGAGAACCTGCAGAACTCGAGTTCTGCAGGTTCTCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-1484s1c1
Sequence:CCGGCCAGACACAGACATATCCACACTCGAGTGTGGATATGTCTGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012127.2-1259s1c1
Sequence:CCGGGCACTTAGTGCTGCAACAGAACTCGAGTTCTGTTGCAGCACTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-2445s21c1
Sequence:CCGGGAGGATGATGAGGATGAAGAACTCGAGTTCTTCATCCTCATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-632s21c1
Sequence:CCGGCACTCCAAATTTGCAACAGTTCTCGAGAACTGTTGCAAATTTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-1259s21c1
Sequence:CCGGGCACTTAGTGCTGCAACAGAACTCGAGTTCTGTTGCAGCACTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-1635s21c1
Sequence:CCGGCAAACACCAGTTGTGGTTCATCTCGAGATGAACCACAACTGGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012127
VALIDATED
CIZ1 MISSION shRNA shRNA Plasmid DNA
CDKN1A interacting zinc finger protein 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012127.2-2267s1c1
Sequence:CCGGCGTTTGCAACCGCTACTTCAACTCGAGTTGAAGTAGCGGTTGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-632s1c1
Sequence:CCGGCACTCCAAATTTGCAACAGTTCTCGAGAACTGTTGCAAATTTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-781s1c1
Sequence:CCGGCCAATCGAAAGGATTCTTCTTCTCGAGAAGAAGAATCCTTTCGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-2445s1c1
Sequence:CCGGGAGGATGATGAGGATGAAGAACTCGAGTTCTTCATCCTCATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-1635s1c1
Sequence:CCGGCAAACACCAGTTGTGGTTCATCTCGAGATGAACCACAACTGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-1973s1c1
Sequence:CCGGCCTCCAGTTCTTCTGCTACATCTCGAGATGTAGCAGAAGAACTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-1736s1c1
Sequence:CCGGCCAAGTCAGCATGGAAGAGATCTCGAGATCTCTTCCATGCTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-2672s1c1
Sequence:CCGGCCACTTTGAGAACCTGCAGAACTCGAGTTCTGCAGGTTCTCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-1484s1c1
Sequence:CCGGCCAGACACAGACATATCCACACTCGAGTGTGGATATGTCTGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012127.2-1259s1c1
Sequence:CCGGGCACTTAGTGCTGCAACAGAACTCGAGTTCTGTTGCAGCACTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-2445s21c1
Sequence:CCGGGAGGATGATGAGGATGAAGAACTCGAGTTCTTCATCCTCATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-632s21c1
Sequence:CCGGCACTCCAAATTTGCAACAGTTCTCGAGAACTGTTGCAAATTTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-1259s21c1
Sequence:CCGGGCACTTAGTGCTGCAACAGAACTCGAGTTCTGTTGCAGCACTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-1635s21c1
Sequence:CCGGCAAACACCAGTTGTGGTTCATCTCGAGATGAACCACAACTGGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012127
VALIDATED
CIZ1 MISSION shRNA Lentiviral Transduction Particles
CDKN1A interacting zinc finger protein 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012127.2-2267s1c1
Sequence:CCGGCGTTTGCAACCGCTACTTCAACTCGAGTTGAAGTAGCGGTTGCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-632s1c1
Sequence:CCGGCACTCCAAATTTGCAACAGTTCTCGAGAACTGTTGCAAATTTGGAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-781s1c1
Sequence:CCGGCCAATCGAAAGGATTCTTCTTCTCGAGAAGAAGAATCCTTTCGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153258    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-2445s1c1
Sequence:CCGGGAGGATGATGAGGATGAAGAACTCGAGTTCTTCATCCTCATCATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154035    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-1635s1c1
Sequence:CCGGCAAACACCAGTTGTGGTTCATCTCGAGATGAACCACAACTGGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154634    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-1973s1c1
Sequence:CCGGCCTCCAGTTCTTCTGCTACATCTCGAGATGTAGCAGAAGAACTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_012127.2-1736s1c1
Sequence:CCGGCCAAGTCAGCATGGAAGAGATCTCGAGATCTCTTCCATGCTGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-2672s1c1
Sequence:CCGGCCACTTTGAGAACCTGCAGAACTCGAGTTCTGCAGGTTCTCAAAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012127.2-1484s1c1
Sequence:CCGGCCAGACACAGACATATCCACACTCGAGTGTGGATATGTCTGTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012127.2-1259s1c1
Sequence:CCGGGCACTTAGTGCTGCAACAGAACTCGAGTTCTGTTGCAGCACTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-2445s21c1
Sequence:CCGGGAGGATGATGAGGATGAAGAACTCGAGTTCTTCATCCTCATCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-632s21c1
Sequence:CCGGCACTCCAAATTTGCAACAGTTCTCGAGAACTGTTGCAAATTTGGAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-1259s21c1
Sequence:CCGGGCACTTAGTGCTGCAACAGAACTCGAGTTCTGTTGCAGCACTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012127.2-1635s21c1
Sequence:CCGGCAAACACCAGTTGTGGTTCATCTCGAGATGAACCACAACTGGTGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028412
VALIDATED
CIZ1 MISSION shRNA Bacterial Glycerol Stock
CDKN1A interacting zinc finger protein 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-2343s1c1
Sequence:CCGGGCAACTCAGAATTGCGGCTTTCTCGAGAAAGCCGCAATTCTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-647s1c1
Sequence:CCGGCCCAATCGCAAGGATTCTTCTCTCGAGAGAAGAATCCTTGCGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028412.1-812s1c1
Sequence:CCGGGAGCCCTTTGAGACATTGGAACTCGAGTTCCAATGTCTCAAAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-1817s1c1
Sequence:CCGGCCTCGGGACATCCTGGAGAAACTCGAGTTTCTCCAGGATGTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-648s1c1
Sequence:CCGGCCAATCGCAAGGATTCTTCTTCTCGAGAAGAAGAATCCTTGCGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-429s21c1
Sequence:CCGGGTAACCTCCGTGCTTTCAATGCTCGAGCATTGAAAGCACGGAGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-504s21c1
Sequence:CCGGCAAATCTGCAGCAGTTCTTTCCTCGAGGAAAGAACTGCTGCAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-2343s21c1
Sequence:CCGGGCAACTCAGAATTGCGGCTTTCTCGAGAAAGCCGCAATTCTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-2303s21c1
Sequence:CCGGATGGGCTATGTCTGTCAAATCCTCGAGGATTTGACAGACATAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028412.1-647s21c1
Sequence:CCGGCCCAATCGCAAGGATTCTTCTCTCGAGAGAAGAATCCTTGCGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-2270s21c1
Sequence:CCGGACAGCCTATGGTGAGGATTTCCTCGAGGAAATCCTCACCATAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028412
VALIDATED
CIZ1 MISSION shRNA shRNA Plasmid DNA
CDKN1A interacting zinc finger protein 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-2343s1c1
Sequence:CCGGGCAACTCAGAATTGCGGCTTTCTCGAGAAAGCCGCAATTCTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-647s1c1
Sequence:CCGGCCCAATCGCAAGGATTCTTCTCTCGAGAGAAGAATCCTTGCGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028412.1-812s1c1
Sequence:CCGGGAGCCCTTTGAGACATTGGAACTCGAGTTCCAATGTCTCAAAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-1817s1c1
Sequence:CCGGCCTCGGGACATCCTGGAGAAACTCGAGTTTCTCCAGGATGTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-648s1c1
Sequence:CCGGCCAATCGCAAGGATTCTTCTTCTCGAGAAGAAGAATCCTTGCGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-429s21c1
Sequence:CCGGGTAACCTCCGTGCTTTCAATGCTCGAGCATTGAAAGCACGGAGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-504s21c1
Sequence:CCGGCAAATCTGCAGCAGTTCTTTCCTCGAGGAAAGAACTGCTGCAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-2343s21c1
Sequence:CCGGGCAACTCAGAATTGCGGCTTTCTCGAGAAAGCCGCAATTCTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-2303s21c1
Sequence:CCGGATGGGCTATGTCTGTCAAATCCTCGAGGATTTGACAGACATAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028412.1-647s21c1
Sequence:CCGGCCCAATCGCAAGGATTCTTCTCTCGAGAGAAGAATCCTTGCGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-2270s21c1
Sequence:CCGGACAGCCTATGGTGAGGATTTCCTCGAGGAAATCCTCACCATAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028412
VALIDATED
CIZ1 MISSION shRNA Lentiviral Transduction Particles
CDKN1A interacting zinc finger protein 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-2343s1c1
Sequence:CCGGGCAACTCAGAATTGCGGCTTTCTCGAGAAAGCCGCAATTCTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-647s1c1
Sequence:CCGGCCCAATCGCAAGGATTCTTCTCTCGAGAGAAGAATCCTTGCGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028412.1-812s1c1
Sequence:CCGGGAGCCCTTTGAGACATTGGAACTCGAGTTCCAATGTCTCAAAGGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-1817s1c1
Sequence:CCGGCCTCGGGACATCCTGGAGAAACTCGAGTTTCTCCAGGATGTCCCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028412.1-648s1c1
Sequence:CCGGCCAATCGCAAGGATTCTTCTTCTCGAGAAGAAGAATCCTTGCGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-429s21c1
Sequence:CCGGGTAACCTCCGTGCTTTCAATGCTCGAGCATTGAAAGCACGGAGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-504s21c1
Sequence:CCGGCAAATCTGCAGCAGTTCTTTCCTCGAGGAAAGAACTGCTGCAGATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-2343s21c1
Sequence:CCGGGCAACTCAGAATTGCGGCTTTCTCGAGAAAGCCGCAATTCTGAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-2303s21c1
Sequence:CCGGATGGGCTATGTCTGTCAAATCCTCGAGGATTTGACAGACATAGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028412.1-647s21c1
Sequence:CCGGCCCAATCGCAAGGATTCTTCTCTCGAGAGAAGAATCCTTGCGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377072    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028412.1-2270s21c1
Sequence:CCGGACAGCCTATGGTGAGGATTTCCTCGAGGAAATCCTCACCATAGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks