EMAIL THIS PAGE TO A FRIEND

CKAP2

cytoskeleton associated protein 2

108 Gene Product Result for
Synonyms: LB1 TMAP se20-10
Gene ID:
Human(26586) Summary: CKAP2 is a cytoskeleton-associated protein involved in mitotic progression (Seki and Fang, 2007 [PubMed 17376772]
Mouse(80986) cytoskeleton associated protein 2
Rat(306575) cytoskeleton associated protein 2
chicken(418882) cytoskeleton associated protein 2
dog(477291) cytoskeleton associated protein 2
domestic cat(101097367) cytoskeleton associated protein 2
Horse(100052303) cytoskeleton associated protein 2
cow(515249) cytoskeleton associated protein 2
sheep(101121357) cytoskeleton associated protein 2
naked mole-rat(101724404) cytoskeleton associated protein 2
domestic guinea pig(100722296) cytoskeleton associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018204 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001004140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001004140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001004140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098525 Rosetta Predictions human pricing
NM_018204 Rosetta Predictions human pricing
XM_001073489 Rosetta Predictions rat pricing
XM_224970 Rosetta Predictions rat pricing
NM_001004140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098525 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319307 predicted 1569
2 SASI_Hs02_00319308 predicted 1518
3 SASI_Hs02_00319309 predicted 1128
4 SASI_Hs02_00319310 predicted 1691
5 SASI_Hs02_00319311 predicted 1144
6 SASI_Hs02_00319312 predicted 1584
7 SASI_Hs02_00319313 predicted 1609
8 SASI_Hs02_00319314 predicted 2347
9 SASI_Hs02_00319315 predicted 1268
10 SASI_Hs02_00319316 predicted 1601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00351495 predicted 1565
2 SASI_Hs02_00351496 predicted 1509
3 SASI_Hs02_00351497 predicted 1133
4 SASI_Hs01_00186235 predicted 1691
5 SASI_Hs02_00351498 predicted 1143
6 SASI_Hs01_00186238 predicted 1580
7 SASI_Hs01_00186239 predicted 1608
8 SASI_Hs01_00186240 predicted 2345
9 SASI_Hs02_00351499 predicted 1265
10 SASI_Hs02_00351500 predicted 1601
11 SASI_Hs01_00186236 predicted 421
12 SASI_Hs01_00186237 predicted 787
13 SASI_Hs01_00186241 predicted 521
14 SASI_Hs01_00186242 predicted 2238
15 SASI_Hs01_00186243 predicted 883
16 SASI_Hs01_00186244 predicted 799
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073489 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00343041 predicted 2057
2 SASI_Rn02_00343042 predicted 2047
3 SASI_Rn02_00343043 predicted 341
4 SASI_Rn02_00343044 predicted 2065
5 SASI_Rn02_00343045 predicted 952
6 SASI_Rn02_00343046 predicted 970
7 SASI_Rn02_00343047 predicted 1406
8 SASI_Rn02_00343048 predicted 542
9 SASI_Rn02_00343049 predicted 1387
10 SASI_Rn02_00343050 predicted 1482
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224970 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382397 predicted 349
2 SASI_Rn02_00382398 predicted 404
3 SASI_Rn02_00382399 predicted 343
4 SASI_Rn02_00382400 predicted 459
5 SASI_Rn02_00382401 predicted 365
6 SASI_Rn02_00382402 predicted 310
7 SASI_Rn02_00382403 predicted 573
8 SASI_Rn02_00382404 predicted 577
9 SASI_Rn02_00382405 predicted 421
10 SASI_Rn02_00382406 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00030540 predicted 1598
2 SASI_Mm01_00030542 predicted 1377
3 SASI_Mm01_00030543 predicted 1691
4 SASI_Mm01_00030544 predicted 1269
5 SASI_Mm01_00030545 predicted 2035
6 SASI_Mm01_00030546 predicted 1732
7 SASI_Mm01_00030547 predicted 1031
8 SASI_Mm01_00030548 predicted 1329
9 SASI_Mm01_00030549 predicted 541
10 SASI_Mm02_00286445 predicted 1396
11 SASI_Mm01_00030541 predicted 632
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018204
VALIDATED
CKAP2 MISSION shRNA Bacterial Glycerol Stock
cytoskeleton associated protein 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-2226s21c1
Sequence:CCGGTATGAGGCTGATACAACATAACTCGAGTTATGTTGTATCAGCCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-2537s21c1
Sequence:CCGGCCCTGTTCACTTTACTAAATACTCGAGTATTTAGTAAAGTGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-954s21c1
Sequence:CCGGCGACCTCCTATTAGAAGTCATCTCGAGATGACTTCTAATAGGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-898s21c1
Sequence:CCGGATATGACTGCCACTACTAAATCTCGAGATTTAGTAGTGGCAGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-576s21c1
Sequence:CCGGCCGCATTTGTTACTAACTGAACTCGAGTTCAGTTAGTAACAAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-2302s1c1
Sequence:CCGGGCAAGAGTTGTCCTCTACATTCTCGAGAATGTAGAGGACAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-853s1c1
Sequence:CCGGCGACCTCCTATTAGAAGTCATCTCGAGATGACTTCTAATAGGAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-475s1c1
Sequence:CCGGCCGCATTTGTTACTAACTGAACTCGAGTTCAGTTAGTAACAAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-2436s1c1
Sequence:CCGGCCCTGTTCACTTTACTAAATACTCGAGTATTTAGTAAAGTGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-2867s1c1
Sequence:CCGGCCACATTTAGTGGTTTAACTTCTCGAGAAGTTAAACCACTAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018204.2-794s1c1
Sequence:CCGGCCAATATGACTGCCACTACTACTCGAGTAGTAGTGGCAGTCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018204.2-1921s1c1
Sequence:CCGGGATGGAACAAATTCCGCATTTCTCGAGAAATGCGGAATTTGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018204
VALIDATED
CKAP2 MISSION shRNA shRNA Plasmid DNA
cytoskeleton associated protein 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-2226s21c1
Sequence:CCGGTATGAGGCTGATACAACATAACTCGAGTTATGTTGTATCAGCCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-2537s21c1
Sequence:CCGGCCCTGTTCACTTTACTAAATACTCGAGTATTTAGTAAAGTGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-954s21c1
Sequence:CCGGCGACCTCCTATTAGAAGTCATCTCGAGATGACTTCTAATAGGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-898s21c1
Sequence:CCGGATATGACTGCCACTACTAAATCTCGAGATTTAGTAGTGGCAGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-576s21c1
Sequence:CCGGCCGCATTTGTTACTAACTGAACTCGAGTTCAGTTAGTAACAAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-2302s1c1
Sequence:CCGGGCAAGAGTTGTCCTCTACATTCTCGAGAATGTAGAGGACAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-853s1c1
Sequence:CCGGCGACCTCCTATTAGAAGTCATCTCGAGATGACTTCTAATAGGAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-475s1c1
Sequence:CCGGCCGCATTTGTTACTAACTGAACTCGAGTTCAGTTAGTAACAAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-2436s1c1
Sequence:CCGGCCCTGTTCACTTTACTAAATACTCGAGTATTTAGTAAAGTGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-2867s1c1
Sequence:CCGGCCACATTTAGTGGTTTAACTTCTCGAGAAGTTAAACCACTAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018204.2-794s1c1
Sequence:CCGGCCAATATGACTGCCACTACTACTCGAGTAGTAGTGGCAGTCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018204.2-1921s1c1
Sequence:CCGGGATGGAACAAATTCCGCATTTCTCGAGAAATGCGGAATTTGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018204
VALIDATED
CKAP2 MISSION shRNA Lentiviral Transduction Particles
cytoskeleton associated protein 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-2226s21c1
Sequence:CCGGTATGAGGCTGATACAACATAACTCGAGTTATGTTGTATCAGCCTCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330455    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-2537s21c1
Sequence:CCGGCCCTGTTCACTTTACTAAATACTCGAGTATTTAGTAAAGTGAACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-954s21c1
Sequence:CCGGCGACCTCCTATTAGAAGTCATCTCGAGATGACTTCTAATAGGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-898s21c1
Sequence:CCGGATATGACTGCCACTACTAAATCTCGAGATTTAGTAGTGGCAGTCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_018204.3-576s21c1
Sequence:CCGGCCGCATTTGTTACTAACTGAACTCGAGTTCAGTTAGTAACAAATGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168564    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-2302s1c1
Sequence:CCGGGCAAGAGTTGTCCTCTACATTCTCGAGAATGTAGAGGACAACTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-853s1c1
Sequence:CCGGCGACCTCCTATTAGAAGTCATCTCGAGATGACTTCTAATAGGAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-475s1c1
Sequence:CCGGCCGCATTTGTTACTAACTGAACTCGAGTTCAGTTAGTAACAAATGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167132    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-2436s1c1
Sequence:CCGGCCCTGTTCACTTTACTAAATACTCGAGTATTTAGTAAAGTGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167289    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_018204.2-2867s1c1
Sequence:CCGGCCACATTTAGTGGTTTAACTTCTCGAGAAGTTAAACCACTAAATGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167964    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018204.2-794s1c1
Sequence:CCGGCCAATATGACTGCCACTACTACTCGAGTAGTAGTGGCAGTCATATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018204.2-1921s1c1
Sequence:CCGGGATGGAACAAATTCCGCATTTCTCGAGAAATGCGGAATTTGTTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004140
VALIDATED
CKAP2 MISSION shRNA Bacterial Glycerol Stock
cytoskeleton associated protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-452s21c1
Sequence:CCGGACCCGGCATGTCACCATAAAGCTCGAGCTTTATGGTGACATGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004140.1-1732s21c1
Sequence:CCGGGGTTGCATAATTCGATATAATCTCGAGATTATATCGAATTATGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-2101s21c1
Sequence:CCGGTTGTCCGCATGCCTAAGTATGCTCGAGCATACTTAGGCATGCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-1277s21c1
Sequence:CCGGCTGAATGCCTGAACCTTATTACTCGAGTAATAAGGTTCAGGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-533s21c1
Sequence:CCGGAGCGAGTGCTTGGCTATTATCCTCGAGGATAATAGCCAAGCACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004140.1-1277s1c1
Sequence:CCGGCTGAATGCCTGAACCTTATTACTCGAGTAATAAGGTTCAGGCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004140.1-1729s1c1
Sequence:CCGGGCAGGTTGCATAATTCGATATCTCGAGATATCGAATTATGCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004140.1-2112s1c1
Sequence:CCGGCCTAAGTATGGTACAGGTGAACTCGAGTTCACCTGTACCATACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004140.1-971s1c1
Sequence:CCGGCCAGGACTGATTCGTCTAATACTCGAGTATTAGACGAATCAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004140
VALIDATED
CKAP2 MISSION shRNA shRNA Plasmid DNA
cytoskeleton associated protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-452s21c1
Sequence:CCGGACCCGGCATGTCACCATAAAGCTCGAGCTTTATGGTGACATGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004140.1-1732s21c1
Sequence:CCGGGGTTGCATAATTCGATATAATCTCGAGATTATATCGAATTATGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-2101s21c1
Sequence:CCGGTTGTCCGCATGCCTAAGTATGCTCGAGCATACTTAGGCATGCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-1277s21c1
Sequence:CCGGCTGAATGCCTGAACCTTATTACTCGAGTAATAAGGTTCAGGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-533s21c1
Sequence:CCGGAGCGAGTGCTTGGCTATTATCCTCGAGGATAATAGCCAAGCACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004140.1-1277s1c1
Sequence:CCGGCTGAATGCCTGAACCTTATTACTCGAGTAATAAGGTTCAGGCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004140.1-1729s1c1
Sequence:CCGGGCAGGTTGCATAATTCGATATCTCGAGATATCGAATTATGCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004140.1-2112s1c1
Sequence:CCGGCCTAAGTATGGTACAGGTGAACTCGAGTTCACCTGTACCATACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004140.1-971s1c1
Sequence:CCGGCCAGGACTGATTCGTCTAATACTCGAGTATTAGACGAATCAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004140
VALIDATED
CKAP2 MISSION shRNA Lentiviral Transduction Particles
cytoskeleton associated protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252022    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-452s21c1
Sequence:CCGGACCCGGCATGTCACCATAAAGCTCGAGCTTTATGGTGACATGCCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001004140.1-1732s21c1
Sequence:CCGGGGTTGCATAATTCGATATAATCTCGAGATTATATCGAATTATGCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-2101s21c1
Sequence:CCGGTTGTCCGCATGCCTAAGTATGCTCGAGCATACTTAGGCATGCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-1277s21c1
Sequence:CCGGCTGAATGCCTGAACCTTATTACTCGAGTAATAAGGTTCAGGCATTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001004140.1-533s21c1
Sequence:CCGGAGCGAGTGCTTGGCTATTATCCTCGAGGATAATAGCCAAGCACTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217780    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004140.1-1277s1c1
Sequence:CCGGCTGAATGCCTGAACCTTATTACTCGAGTAATAAGGTTCAGGCATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200777    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004140.1-1729s1c1
Sequence:CCGGGCAGGTTGCATAATTCGATATCTCGAGATATCGAATTATGCAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192466    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004140.1-2112s1c1
Sequence:CCGGCCTAAGTATGGTACAGGTGAACTCGAGTTCACCTGTACCATACTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004140.1-971s1c1
Sequence:CCGGCCAGGACTGATTCGTCTAATACTCGAGTATTAGACGAATCAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks