EMAIL THIS PAGE TO A FRIEND

CKAP2L

cytoskeleton associated protein 2-like

85 Gene Product Result for
UniProtKB ID: Q8IYA6, A8K915, Q53QF8, Q53RS8, Q8N1J8
Gene ID:
Mouse(70466) cytoskeleton associated protein 2-like
Rat(680515) cytoskeleton associated protein 2-like
domestic guinea pig(100712987) cytoskeleton associated protein 2-like
naked mole-rat(101703564) cytoskeleton associated protein 2-like
sheep(101112209) cytoskeleton associated protein 2-like
Domestic Rabbit(100358850) cytoskeleton associated protein 2-like
chicken(426694) cytoskeleton associated protein 2-like
domestic cat(101097473) cytoskeleton associated protein 2-like
Horse(100052298) cytoskeleton associated protein 2-like
cow(507498) cytoskeleton associated protein 2-like
dog(475753) cytoskeleton associated protein 2-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152515 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_181589 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_181589 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_181589 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152515 Rosetta Predictions human pricing
XM_001057508 Rosetta Predictions rat pricing
NM_181589 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366298 predicted 206
2 SASI_Hs02_00366299 predicted 1292
3 SASI_Hs02_00366300 predicted 1193
4 SASI_Hs01_00028316 predicted 1267
5 SASI_Hs01_00028318 predicted 691
6 SASI_Hs01_00028319 predicted 2401
7 SASI_Hs01_00028320 predicted 625
8 SASI_Hs01_00028321 predicted 1900
9 SASI_Hs01_00028324 predicted 868
10 SASI_Hs02_00366301 predicted 522
11 SASI_Hs01_00028315 predicted 638
12 SASI_Hs01_00028317 predicted 663
13 SASI_Hs01_00028322 predicted 865
14 SASI_Hs01_00028323 predicted 2028
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057508 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286636 predicted 1154
2 SASI_Rn02_00286637 predicted 503
3 SASI_Rn02_00286638 predicted 645
4 SASI_Rn02_00286639 predicted 1162
5 SASI_Rn02_00286640 predicted 1678
6 SASI_Rn02_00286641 predicted 655
7 SASI_Rn02_00286642 predicted 778
8 SASI_Rn02_00286643 predicted 839
9 SASI_Rn02_00286644 predicted 871
10 SASI_Rn02_00286645 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181589 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00349858 predicted 1194
2 SASI_Mm01_00152830 predicted 233
3 SASI_Mm01_00152831 predicted 948
4 SASI_Mm01_00152832 predicted 698
5 SASI_Mm01_00152833 predicted 999
6 SASI_Mm01_00152834 predicted 838
7 SASI_Mm01_00152835 predicted 979
8 SASI_Mm01_00152836 predicted 717
9 SASI_Mm01_00152837 predicted 242
10 SASI_Mm01_00152838 predicted 1144
11 SASI_Mm01_00152839 predicted 1852
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152515
VALIDATED
CKAP2L MISSION shRNA Bacterial Glycerol Stock
cytoskeleton associated protein 2-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152515.2-1695s1c1
Sequence:CCGGGCAAAGTTGTTGGCAAGTAAACTCGAGTTTACTTGCCAACAACTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152515.2-865s1c1
Sequence:CCGGCCCTTAGTAAAGTTCAGTCATCTCGAGATGACTGAACTTTACTAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152515.2-142s1c1
Sequence:CCGGGCCAGAATCAACCACCTTCTACTCGAGTAGAAGGTGGTTGATTCTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-2805s21c1
Sequence:CCGGCCTTTGCTCAGAGATCATAAACTCGAGTTTATGATCTCTGAGCAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152515.3-1400s21c1
Sequence:CCGGGCTGATGTCACAACCGTAAATCTCGAGATTTACGGTTGTGACATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-1805s21c1
Sequence:CCGGCTATATGAAGAGGCCATTAAACTCGAGTTTAATGGCCTCTTCATATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-221s21c1
Sequence:CCGGCCACCTTCTAAATCTACTATTCTCGAGAATAGTAGATTTAGAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-1201s21c1
Sequence:CCGGCATAAGCCAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTGGCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152515
VALIDATED
CKAP2L MISSION shRNA shRNA Plasmid DNA
cytoskeleton associated protein 2-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152515.2-1695s1c1
Sequence:CCGGGCAAAGTTGTTGGCAAGTAAACTCGAGTTTACTTGCCAACAACTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152515.2-865s1c1
Sequence:CCGGCCCTTAGTAAAGTTCAGTCATCTCGAGATGACTGAACTTTACTAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152515.2-142s1c1
Sequence:CCGGGCCAGAATCAACCACCTTCTACTCGAGTAGAAGGTGGTTGATTCTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-2805s21c1
Sequence:CCGGCCTTTGCTCAGAGATCATAAACTCGAGTTTATGATCTCTGAGCAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152515.3-1400s21c1
Sequence:CCGGGCTGATGTCACAACCGTAAATCTCGAGATTTACGGTTGTGACATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-1805s21c1
Sequence:CCGGCTATATGAAGAGGCCATTAAACTCGAGTTTAATGGCCTCTTCATATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-221s21c1
Sequence:CCGGCCACCTTCTAAATCTACTATTCTCGAGAATAGTAGATTTAGAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000243044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-1201s21c1
Sequence:CCGGCATAAGCCAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTGGCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152515
VALIDATED
CKAP2L MISSION shRNA Lentiviral Transduction Particles
cytoskeleton associated protein 2-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168376    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152515.2-1695s1c1
Sequence:CCGGGCAAAGTTGTTGGCAAGTAAACTCGAGTTTACTTGCCAACAACTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152515.2-865s1c1
Sequence:CCGGCCCTTAGTAAAGTTCAGTCATCTCGAGATGACTGAACTTTACTAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152515.2-142s1c1
Sequence:CCGGGCCAGAATCAACCACCTTCTACTCGAGTAGAAGGTGGTTGATTCTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243045    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-2805s21c1
Sequence:CCGGCCTTTGCTCAGAGATCATAAACTCGAGTTTATGATCTCTGAGCAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_152515.3-1400s21c1
Sequence:CCGGGCTGATGTCACAACCGTAAATCTCGAGATTTACGGTTGTGACATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-1805s21c1
Sequence:CCGGCTATATGAAGAGGCCATTAAACTCGAGTTTAATGGCCTCTTCATATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-221s21c1
Sequence:CCGGCCACCTTCTAAATCTACTATTCTCGAGAATAGTAGATTTAGAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000243044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_152515.3-1201s21c1
Sequence:CCGGCATAAGCCAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTGGCTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181589
VALIDATED
CKAP2L MISSION shRNA Bacterial Glycerol Stock
cytoskeleton associated protein 2-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-1926s1c1
Sequence:CCGGCCTTGCCCATCTCTAACAGAACTCGAGTTCTGTTAGAGATGGGCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181589.2-2326s1c1
Sequence:CCGGGCAAGACATAAATGCCCTTGTCTCGAGACAAGGGCATTTATGTCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181589.2-119s21c1
Sequence:CCGGCAACGCCAAGCCTTATCTAAACTCGAGTTTAGATAAGGCTTGGCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181589.2-2326s21c1
Sequence:CCGGGCAAGACATAAATGCCCTTGTCTCGAGACAAGGGCATTTATGTCTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181589.2-856s21c1
Sequence:CCGGATTCCGTTCCAGCCCATAATACTCGAGTATTATGGGCTGGAACGGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181589.2-1139s21c1
Sequence:CCGGCATAAGCCAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTGGCTTATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181589.2-229s21c1
Sequence:CCGGCTACAAGACCCATCAACATTACTCGAGTAATGTTGATGGGTCTTGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-1139s1c1
Sequence:CCGGCATAAGCCAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTGGCTTATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-229s1c1
Sequence:CCGGCTACAAGACCCATCAACATTACTCGAGTAATGTTGATGGGTCTTGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-119s1c1
Sequence:CCGGCAACGCCAAGCCTTATCTAAACTCGAGTTTAGATAAGGCTTGGCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181589
VALIDATED
CKAP2L MISSION shRNA shRNA Plasmid DNA
cytoskeleton associated protein 2-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-1926s1c1
Sequence:CCGGCCTTGCCCATCTCTAACAGAACTCGAGTTCTGTTAGAGATGGGCAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181589.2-2326s1c1
Sequence:CCGGGCAAGACATAAATGCCCTTGTCTCGAGACAAGGGCATTTATGTCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181589.2-119s21c1
Sequence:CCGGCAACGCCAAGCCTTATCTAAACTCGAGTTTAGATAAGGCTTGGCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181589.2-2326s21c1
Sequence:CCGGGCAAGACATAAATGCCCTTGTCTCGAGACAAGGGCATTTATGTCTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181589.2-856s21c1
Sequence:CCGGATTCCGTTCCAGCCCATAATACTCGAGTATTATGGGCTGGAACGGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181589.2-1139s21c1
Sequence:CCGGCATAAGCCAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTGGCTTATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000249891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181589.2-229s21c1
Sequence:CCGGCTACAAGACCCATCAACATTACTCGAGTAATGTTGATGGGTCTTGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-1139s1c1
Sequence:CCGGCATAAGCCAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTGGCTTATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-229s1c1
Sequence:CCGGCTACAAGACCCATCAACATTACTCGAGTAATGTTGATGGGTCTTGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000217261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-119s1c1
Sequence:CCGGCAACGCCAAGCCTTATCTAAACTCGAGTTTAGATAAGGCTTGGCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181589
VALIDATED
CKAP2L MISSION shRNA Lentiviral Transduction Particles
cytoskeleton associated protein 2-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184410    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-1926s1c1
Sequence:CCGGCCTTGCCCATCTCTAACAGAACTCGAGTTCTGTTAGAGATGGGCAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179178    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181589.2-2326s1c1
Sequence:CCGGGCAAGACATAAATGCCCTTGTCTCGAGACAAGGGCATTTATGTCTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181589.2-119s21c1
Sequence:CCGGCAACGCCAAGCCTTATCTAAACTCGAGTTTAGATAAGGCTTGGCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249889    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181589.2-2326s21c1
Sequence:CCGGGCAAGACATAAATGCCCTTGTCTCGAGACAAGGGCATTTATGTCTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181589.2-856s21c1
Sequence:CCGGATTCCGTTCCAGCCCATAATACTCGAGTATTATGGGCTGGAACGGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181589.2-1139s21c1
Sequence:CCGGCATAAGCCAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTGGCTTATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000249891    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_181589.2-229s21c1
Sequence:CCGGCTACAAGACCCATCAACATTACTCGAGTAATGTTGATGGGTCTTGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217080    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-1139s1c1
Sequence:CCGGCATAAGCCAGAGGCCTAATTTCTCGAGAAATTAGGCCTCTGGCTTATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217206    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-229s1c1
Sequence:CCGGCTACAAGACCCATCAACATTACTCGAGTAATGTTGATGGGTCTTGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000217261    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_181589.2-119s1c1
Sequence:CCGGCAACGCCAAGCCTTATCTAAACTCGAGTTTAGATAAGGCTTGGCGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)