EMAIL THIS PAGE TO A FRIEND

CKAP4

cytoskeleton-associated protein 4

54 Gene Product Result for
Synonyms: CLIMP-63 ERGIC-63 p63
UniProtKB ID: Q07065, Q504S5, Q53ES6
Gene ID:
Mouse(216197) cytoskeleton-associated protein 4
Rat(362859) cytoskeleton-associated protein 4
chicken(418073) cytoskeleton-associated protein 4
cow(515784) cytoskeleton-associated protein 4
Horse(100068385) cytoskeleton-associated protein 4
domestic cat(101089875) cytoskeleton-associated protein 4
dog(481295) cytoskeleton-associated protein 4
sheep(101114945) cytoskeleton-associated protein 4
naked mole-rat(101700263) cytoskeleton-associated protein 4
domestic guinea pig(100720288) cytoskeleton-associated protein 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006825 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175451 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175451 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175451 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006825 Rosetta Predictions human pricing
NM_001108740 Rosetta Predictions rat pricing
NM_175451 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014070 predicted 1844
2 SASI_Hs02_00342379 predicted 767
3 SASI_Hs01_00014072 predicted 1002
4 SASI_Hs01_00014073 predicted 812
5 SASI_Hs01_00014074 predicted 1268
6 SASI_Hs01_00014076 predicted 831
7 SASI_Hs01_00014078 predicted 1270
8 SASI_Hs01_00014079 predicted 1918
9 SASI_Hs02_00342380 predicted 943
10 SASI_Hs02_00342381 predicted 1015
11 SASI_Hs01_00014071 predicted 1919
12 SASI_Hs01_00014075 predicted 577
13 SASI_Hs01_00014077 predicted 568
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108740 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241615 predicted 862
2 SASI_Rn02_00241616 predicted 536
3 SASI_Rn02_00241617 predicted 878
4 SASI_Rn02_00241618 predicted 643
5 SASI_Rn02_00241619 predicted 1267
6 SASI_Rn02_00241620 predicted 622
7 SASI_Rn02_00241621 predicted 1035
8 SASI_Rn02_00241622 predicted 856
9 SASI_Rn02_00241623 predicted 1290
10 SASI_Rn02_00241624 predicted 752
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175451 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00122845 predicted 676
2 SASI_Mm01_00122846 predicted 498
3 SASI_Mm01_00122847 predicted 552
4 SASI_Mm01_00122848 predicted 1117
5 SASI_Mm01_00122849 predicted 736
6 SASI_Mm01_00122850 predicted 1526
7 SASI_Mm02_00346353 predicted 1001
8 SASI_Mm01_00122851 predicted 441
9 SASI_Mm01_00122853 predicted 949
10 SASI_Mm01_00122854 predicted 886
11 SASI_Mm01_00122852 predicted 1146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006825
VALIDATED
CKAP4 MISSION shRNA Bacterial Glycerol Stock
cytoskeleton-associated protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-1805s21c1
Sequence:CCGGTGGAATCAGCCAAGGGTTTACCTCGAGGTAAACCCTTGGCTGATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006825.3-1913s21c1
Sequence:CCGGCGCGGATTTAAAGTCCAATTTCTCGAGAAATTGGACTTTAAATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-609s21c1
Sequence:CCGGCTTGAGAAGCTCCCAACATAACTCGAGTTATGTTGGGAGCTTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-1846s21c1
Sequence:CCGGCTGGATAGGTTGTTTGTGAAACTCGAGTTTCACAAACAACCTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-933s21c1
Sequence:CCGGGCAGGATTTGAAAGCCTTAAACTCGAGTTTAAGGCTTTCAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006825.2-2117s1c1
Sequence:CCGGCCTGTGAATAACAGGTGGCTTCTCGAGAAGCCACCTGTTATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-579s1c1
Sequence:CCGGGCAAGCCACATTTGGAACTTTCTCGAGAAAGTTCCAAATGTGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-1846s1c1
Sequence:CCGGCTGGATAGGTTGTTTGTGAAACTCGAGTTTCACAAACAACCTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-703s1c1
Sequence:CCGGCTCCAGAATGAGATTCTCAAACTCGAGTTTGAGAATCTCATTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-933s1c1
Sequence:CCGGGCAGGATTTGAAAGCCTTAAACTCGAGTTTAAGGCTTTCAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006825
VALIDATED
CKAP4 MISSION shRNA shRNA Plasmid DNA
cytoskeleton-associated protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-1805s21c1
Sequence:CCGGTGGAATCAGCCAAGGGTTTACCTCGAGGTAAACCCTTGGCTGATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006825.3-1913s21c1
Sequence:CCGGCGCGGATTTAAAGTCCAATTTCTCGAGAAATTGGACTTTAAATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-609s21c1
Sequence:CCGGCTTGAGAAGCTCCCAACATAACTCGAGTTATGTTGGGAGCTTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-1846s21c1
Sequence:CCGGCTGGATAGGTTGTTTGTGAAACTCGAGTTTCACAAACAACCTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-933s21c1
Sequence:CCGGGCAGGATTTGAAAGCCTTAAACTCGAGTTTAAGGCTTTCAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006825.2-2117s1c1
Sequence:CCGGCCTGTGAATAACAGGTGGCTTCTCGAGAAGCCACCTGTTATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-579s1c1
Sequence:CCGGGCAAGCCACATTTGGAACTTTCTCGAGAAAGTTCCAAATGTGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-1846s1c1
Sequence:CCGGCTGGATAGGTTGTTTGTGAAACTCGAGTTTCACAAACAACCTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-703s1c1
Sequence:CCGGCTCCAGAATGAGATTCTCAAACTCGAGTTTGAGAATCTCATTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-933s1c1
Sequence:CCGGGCAGGATTTGAAAGCCTTAAACTCGAGTTTAAGGCTTTCAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006825
VALIDATED
CKAP4 MISSION shRNA Lentiviral Transduction Particles
cytoskeleton-associated protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-1805s21c1
Sequence:CCGGTGGAATCAGCCAAGGGTTTACCTCGAGGTAAACCCTTGGCTGATTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006825.3-1913s21c1
Sequence:CCGGCGCGGATTTAAAGTCCAATTTCTCGAGAAATTGGACTTTAAATCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296261    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-609s21c1
Sequence:CCGGCTTGAGAAGCTCCCAACATAACTCGAGTTATGTTGGGAGCTTCTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-1846s21c1
Sequence:CCGGCTGGATAGGTTGTTTGTGAAACTCGAGTTTCACAAACAACCTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006825.3-933s21c1
Sequence:CCGGGCAGGATTTGAAAGCCTTAAACTCGAGTTTAAGGCTTTCAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006825.2-2117s1c1
Sequence:CCGGCCTGTGAATAACAGGTGGCTTCTCGAGAAGCCACCTGTTATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-579s1c1
Sequence:CCGGGCAAGCCACATTTGGAACTTTCTCGAGAAAGTTCCAAATGTGGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-1846s1c1
Sequence:CCGGCTGGATAGGTTGTTTGTGAAACTCGAGTTTCACAAACAACCTATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-703s1c1
Sequence:CCGGCTCCAGAATGAGATTCTCAAACTCGAGTTTGAGAATCTCATTCTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006825.2-933s1c1
Sequence:CCGGGCAGGATTTGAAAGCCTTAAACTCGAGTTTAAGGCTTTCAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175451
VALIDATED
CKAP4 MISSION shRNA Bacterial Glycerol Stock
cytoskeleton-associated protein 4
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175451.1-2714s21c1
Sequence:CCGGGCCCTTTGAGATGTATTGTTTCTCGAGAAACAATACATCTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-1698s21c1
Sequence:CCGGACGACCTGGATAGGTTGTTTCCTCGAGGAAACAACCTATCCAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-1642s21c1
Sequence:CCGGCGAAACGAATGAGAATAACTTCTCGAGAAGTTATTCTCATTCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-693s21c1
Sequence:CCGGCCAAGTCTATCAATGACAACACTCGAGTGTTGTCATTGATAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-540s21c1
Sequence:CCGGAGAGCGAGCTCAACCGAATTACTCGAGTAATTCGGTTGAGCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-1133s1c1
Sequence:CCGGGCCGTCTTCAAAGACTCCAAACTCGAGTTTGGAGTCTTTGAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175451.1-694s1c1
Sequence:CCGGCAAGTCTATCAATGACAACATCTCGAGATGTTGTCATTGATAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175451.1-693s1c1
Sequence:CCGGCCAAGTCTATCAATGACAACACTCGAGTGTTGTCATTGATAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175451.1-1642s1c1
Sequence:CCGGCGAAACGAATGAGAATAACTTCTCGAGAAGTTATTCTCATTCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175451.1-2714s1c1
Sequence:CCGGGCCCTTTGAGATGTATTGTTTCTCGAGAAACAATACATCTCAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-682s1c1
Sequence:CCGGGACGGAGCTTACCAAGTCTATCTCGAGATAGACTTGGTAAGCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-454s1c1
Sequence:CCGGGCAAGCCACATTTGGGACTTTCTCGAGAAAGTCCCAAATGTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175451.1-2393s1c1
Sequence:CCGGCCATTCCCTAATCCAATCAAACTCGAGTTTGATTGGATTAGGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-566s1c1
Sequence:CCGGGTTCTACAGAAGTTGCAGAATCTCGAGATTCTGCAACTTCTGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175451
VALIDATED
CKAP4 MISSION shRNA shRNA Plasmid DNA
cytoskeleton-associated protein 4
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175451.1-2714s21c1
Sequence:CCGGGCCCTTTGAGATGTATTGTTTCTCGAGAAACAATACATCTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-1698s21c1
Sequence:CCGGACGACCTGGATAGGTTGTTTCCTCGAGGAAACAACCTATCCAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-1642s21c1
Sequence:CCGGCGAAACGAATGAGAATAACTTCTCGAGAAGTTATTCTCATTCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-693s21c1
Sequence:CCGGCCAAGTCTATCAATGACAACACTCGAGTGTTGTCATTGATAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-540s21c1
Sequence:CCGGAGAGCGAGCTCAACCGAATTACTCGAGTAATTCGGTTGAGCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-1133s1c1
Sequence:CCGGGCCGTCTTCAAAGACTCCAAACTCGAGTTTGGAGTCTTTGAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175451.1-694s1c1
Sequence:CCGGCAAGTCTATCAATGACAACATCTCGAGATGTTGTCATTGATAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175451.1-693s1c1
Sequence:CCGGCCAAGTCTATCAATGACAACACTCGAGTGTTGTCATTGATAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175451.1-1642s1c1
Sequence:CCGGCGAAACGAATGAGAATAACTTCTCGAGAAGTTATTCTCATTCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175451.1-2714s1c1
Sequence:CCGGGCCCTTTGAGATGTATTGTTTCTCGAGAAACAATACATCTCAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-682s1c1
Sequence:CCGGGACGGAGCTTACCAAGTCTATCTCGAGATAGACTTGGTAAGCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-454s1c1
Sequence:CCGGGCAAGCCACATTTGGGACTTTCTCGAGAAAGTCCCAAATGTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175451.1-2393s1c1
Sequence:CCGGCCATTCCCTAATCCAATCAAACTCGAGTTTGATTGGATTAGGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-566s1c1
Sequence:CCGGGTTCTACAGAAGTTGCAGAATCTCGAGATTCTGCAACTTCTGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175451
VALIDATED
CKAP4 MISSION shRNA Lentiviral Transduction Particles
cytoskeleton-associated protein 4
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297302    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175451.1-2714s21c1
Sequence:CCGGGCCCTTTGAGATGTATTGTTTCTCGAGAAACAATACATCTCAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297238    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-1698s21c1
Sequence:CCGGACGACCTGGATAGGTTGTTTCCTCGAGGAAACAACCTATCCAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-1642s21c1
Sequence:CCGGCGAAACGAATGAGAATAACTTCTCGAGAAGTTATTCTCATTCGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-693s21c1
Sequence:CCGGCCAAGTCTATCAATGACAACACTCGAGTGTTGTCATTGATAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175451.1-540s21c1
Sequence:CCGGAGAGCGAGCTCAACCGAATTACTCGAGTAATTCGGTTGAGCTCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-1133s1c1
Sequence:CCGGGCCGTCTTCAAAGACTCCAAACTCGAGTTTGGAGTCTTTGAAGACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175451.1-694s1c1
Sequence:CCGGCAAGTCTATCAATGACAACATCTCGAGATGTTGTCATTGATAGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175451.1-693s1c1
Sequence:CCGGCCAAGTCTATCAATGACAACACTCGAGTGTTGTCATTGATAGACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175451.1-1642s1c1
Sequence:CCGGCGAAACGAATGAGAATAACTTCTCGAGAAGTTATTCTCATTCGTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177489    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175451.1-2714s1c1
Sequence:CCGGGCCCTTTGAGATGTATTGTTTCTCGAGAAACAATACATCTCAAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-682s1c1
Sequence:CCGGGACGGAGCTTACCAAGTCTATCTCGAGATAGACTTGGTAAGCTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200333    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-454s1c1
Sequence:CCGGGCAAGCCACATTTGGGACTTTCTCGAGAAAGTCCCAAATGTGGCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197529    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175451.1-2393s1c1
Sequence:CCGGCCATTCCCTAATCCAATCAAACTCGAGTTTGATTGGATTAGGGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197779    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175451.1-566s1c1
Sequence:CCGGGTTCTACAGAAGTTGCAGAATCTCGAGATTCTGCAACTTCTGTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks