EMAIL THIS PAGE TO A FRIEND

CKAP5

cytoskeleton associated protein 5

172 Gene Product Result for
Synonyms: CHTOG MSPS TOG TOGp ch-TOG
Gene ID:
Human(9793) Summary: This gene encodes a cytoskeleton-associated protein which belongs to the TOG/XMAP215 family. The N-terminal half of this protein contains a microtubule-binding domain and the C-terminal half contains a KXGS motif for binding tubulin dimers. This protein has two distinct roles in spindle formation; it protects kinetochore microtubules from depolymerization and plays an essential role in centrosomal microtubule assembly. This protein may be necessary for the proper interaction of microtubules with the cell cortex for directional cell movement. It also plays a role in translation of the myelin basic protein (MBP) mRNA by interacting with heterogeneous nuclear ribonucleoprotein (hnRNP) A2, which associates with MBP. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Mouse(75786) cytoskeleton associated protein 5
Rat(311191) cytoskeleton associated protein 5
domestic guinea pig(100722796) cytoskeleton associated protein 5
naked mole-rat(101719740) cytoskeleton associated protein 5
sheep(101115651) cytoskeleton associated protein 5
Domestic Rabbit(100351133) cytoskeleton associated protein 5
Zebrafish(492614) cytoskeleton associated protein 5
cow(533980) cytoskeleton associated protein 5
Horse(100050886) cytoskeleton associated protein 5
domestic cat(101090894) cytoskeleton associated protein 5
dog(475986) cytoskeleton associated protein 5
chicken(423190) cytoskeleton associated protein 5
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014756 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014756 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014756 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029437 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029437 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029437 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008938 Rosetta Predictions human pricing
NM_014756 Rosetta Predictions human pricing
XM_001068339 Rosetta Predictions rat pricing
XM_001068589 Rosetta Predictions rat pricing
XM_001068641 Rosetta Predictions rat pricing
XM_001068694 Rosetta Predictions rat pricing
XM_001068742 Rosetta Predictions rat pricing
XM_001068790 Rosetta Predictions rat pricing
XM_001068836 Rosetta Predictions rat pricing
XM_230282 Rosetta Predictions rat pricing
NM_029437 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008938 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305598 predicted 3753
2 SASI_Hs01_00044845 predicted 5379
3 SASI_Hs01_00044846 predicted 1046
4 SASI_Hs01_00044847 predicted 1039
5 SASI_Hs01_00044848 predicted 5917
6 SASI_Hs01_00044849 predicted 6177
7 SASI_Hs02_00305599 predicted 1546
8 SASI_Hs01_00044850 predicted 556
9 SASI_Hs02_00305600 predicted 1293
10 SASI_Hs01_00044851 predicted 5440
11 SASI_Hs01_00044844 predicted 5215
12 SASI_Hs01_00044852 predicted 6150
13 SASI_Hs01_00044853 predicted 3202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346226 predicted 3745
2 SASI_Hs01_00071284 predicted 5203
3 SASI_Hs01_00071285 predicted 1050
4 SASI_Hs01_00071286 predicted 1036
5 SASI_Hs01_00071287 predicted 5734
6 SASI_Hs01_00071288 predicted 6001
7 SASI_Hs02_00346227 predicted 1545
8 SASI_Hs01_00071289 predicted 555
9 SASI_Hs02_00346228 predicted 1294
10 SASI_Hs01_00071290 predicted 5262
11 SASI_Hs01_00071283 predicted 5040
12 SASI_Hs01_00071291 predicted 5967
13 SASI_Hs01_00071292 predicted 3203
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068339 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324227 predicted 4965
2 SASI_Rn02_00324228 predicted 396
3 SASI_Rn02_00324229 predicted 1085
4 SASI_Rn02_00324230 predicted 2783
5 SASI_Rn02_00324231 predicted 2670
6 SASI_Rn02_00324232 predicted 5301
7 SASI_Rn02_00324233 predicted 2339
8 SASI_Rn02_00324234 predicted 6150
9 SASI_Rn02_00324235 predicted 3518
10 SASI_Rn02_00324236 predicted 3249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068589 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325070 predicted 401
2 SASI_Rn02_00325071 predicted 1085
3 SASI_Rn02_00325072 predicted 2783
4 SASI_Rn02_00325073 predicted 2671
5 SASI_Rn02_00325074 predicted 5125
6 SASI_Rn02_00325075 predicted 2343
7 SASI_Rn02_00325076 predicted 3901
8 SASI_Rn02_00325077 predicted 6034
9 SASI_Rn02_00325078 predicted 3510
10 SASI_Rn02_00325079 predicted 3251
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068641 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325276 predicted 4988
2 SASI_Rn02_00325277 predicted 398
3 SASI_Rn02_00325278 predicted 1089
4 SASI_Rn02_00325279 predicted 2782
5 SASI_Rn02_00325280 predicted 2662
6 SASI_Rn02_00325281 predicted 5330
7 SASI_Rn02_00325282 predicted 2341
8 SASI_Rn02_00325283 predicted 6233
9 SASI_Rn02_00325284 predicted 3518
10 SASI_Rn02_00325285 predicted 3247
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068694 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325499 predicted 4799
2 SASI_Rn02_00325500 predicted 922
3 SASI_Rn02_00325501 predicted 2617
4 SASI_Rn02_00325502 predicted 2498
5 SASI_Rn02_00325503 predicted 5141
6 SASI_Rn02_00325504 predicted 2172
7 SASI_Rn02_00325505 predicted 6047
8 SASI_Rn02_00325506 predicted 3345
9 SASI_Rn02_00325507 predicted 3079
10 SASI_Rn02_00325508 predicted 3323
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068742 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325689 predicted 4963
2 SASI_Rn02_00325690 predicted 400
3 SASI_Rn02_00325691 predicted 1093
4 SASI_Rn02_00325692 predicted 2779
5 SASI_Rn02_00325693 predicted 2666
6 SASI_Rn02_00325694 predicted 5305
7 SASI_Rn02_00325695 predicted 2341
8 SASI_Rn02_00325696 predicted 6213
9 SASI_Rn02_00325697 predicted 3510
10 SASI_Rn02_00325698 predicted 3249
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068790 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00325856 predicted 4955
2 SASI_Rn02_00325857 predicted 402
3 SASI_Rn02_00325858 predicted 1089
4 SASI_Rn02_00325859 predicted 2781
5 SASI_Rn02_00325860 predicted 2661
6 SASI_Rn02_00325861 predicted 5297
7 SASI_Rn02_00325862 predicted 2335
8 SASI_Rn02_00325863 predicted 6214
9 SASI_Rn02_00325864 predicted 3509
10 SASI_Rn02_00325865 predicted 3242
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326078 predicted 4858
2 SASI_Rn02_00326079 predicted 304
3 SASI_Rn02_00326080 predicted 993
4 SASI_Rn02_00326081 predicted 2680
5 SASI_Rn02_00326082 predicted 2571
6 SASI_Rn02_00326083 predicted 5210
7 SASI_Rn02_00326084 predicted 2237
8 SASI_Rn02_00326085 predicted 6112
9 SASI_Rn02_00326086 predicted 3416
10 SASI_Rn02_00326087 predicted 3153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_230282 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00386134 predicted 4074
2 SASI_Rn02_00386135 predicted 197
3 SASI_Rn02_00386136 predicted 1891
4 SASI_Rn02_00386137 predicted 1779
5 SASI_Rn02_00386138 predicted 4412
6 SASI_Rn02_00386139 predicted 1450
7 SASI_Rn02_00386140 predicted 3012
8 SASI_Rn02_00386141 predicted 5317
9 SASI_Rn02_00386142 predicted 2621
10 SASI_Rn02_00386143 predicted 2356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029437 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041195 predicted 1041
2 SASI_Mm01_00041196 predicted 3389
3 SASI_Mm01_00041197 predicted 5696
4 SASI_Mm01_00041198 predicted 6029
5 SASI_Mm01_00041199 predicted 3627
6 SASI_Mm01_00041200 predicted 275
7 SASI_Mm01_00041201 predicted 464
8 SASI_Mm01_00041202 predicted 433
9 SASI_Mm01_00041203 predicted 3101
10 SASI_Mm02_00335360 predicted 961
11 SASI_Mm01_00041194 predicted 4845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014756
VALIDATED
CKAP5 MISSION shRNA Bacterial Glycerol Stock
cytoskeleton associated protein 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-6052s1c1
Sequence:CCGGCCTGCAGCTTTAGTTTACTAACTCGAGTTAGTAAACTAAAGCTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-1050s1c1
Sequence:CCGGGCTGGCGATTATGCAGATTTACTCGAGTAAATCTGCATAATCGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-5973s1c1
Sequence:CCGGGCTAACATAGACGACTTGAAACTCGAGTTTCAAGTCGTCTATGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-2572s1c1
Sequence:CCGGCCAGAGGAATTTCCAAGCATACTCGAGTATGCTTGGAAATTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-4434s1c1
Sequence:CCGGGCACAGAACATAAGCTCCAATCTCGAGATTGGAGCTTATGTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014756.2-5973s21c1
Sequence:CCGGGCTAACATAGACGACTTGAAACTCGAGTTTCAAGTCGTCTATGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-2572s21c1
Sequence:CCGGCCAGAGGAATTTCCAAGCATACTCGAGTATGCTTGGAAATTCCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-1050s21c1
Sequence:CCGGGCTGGCGATTATGCAGATTTACTCGAGTAAATCTGCATAATCGCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-6052s21c1
Sequence:CCGGCCTGCAGCTTTAGTTTACTAACTCGAGTTAGTAAACTAAAGCTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-4434s21c1
Sequence:CCGGGCACAGAACATAAGCTCCAATCTCGAGATTGGAGCTTATGTTCTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014756
VALIDATED
CKAP5 MISSION shRNA shRNA Plasmid DNA
cytoskeleton associated protein 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-6052s1c1
Sequence:CCGGCCTGCAGCTTTAGTTTACTAACTCGAGTTAGTAAACTAAAGCTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-1050s1c1
Sequence:CCGGGCTGGCGATTATGCAGATTTACTCGAGTAAATCTGCATAATCGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-5973s1c1
Sequence:CCGGGCTAACATAGACGACTTGAAACTCGAGTTTCAAGTCGTCTATGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-2572s1c1
Sequence:CCGGCCAGAGGAATTTCCAAGCATACTCGAGTATGCTTGGAAATTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000113887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-4434s1c1
Sequence:CCGGGCACAGAACATAAGCTCCAATCTCGAGATTGGAGCTTATGTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014756.2-5973s21c1
Sequence:CCGGGCTAACATAGACGACTTGAAACTCGAGTTTCAAGTCGTCTATGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-2572s21c1
Sequence:CCGGCCAGAGGAATTTCCAAGCATACTCGAGTATGCTTGGAAATTCCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-1050s21c1
Sequence:CCGGGCTGGCGATTATGCAGATTTACTCGAGTAAATCTGCATAATCGCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-6052s21c1
Sequence:CCGGCCTGCAGCTTTAGTTTACTAACTCGAGTTAGTAAACTAAAGCTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-4434s21c1
Sequence:CCGGGCACAGAACATAAGCTCCAATCTCGAGATTGGAGCTTATGTTCTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014756
VALIDATED
CKAP5 MISSION shRNA Lentiviral Transduction Particles
cytoskeleton associated protein 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113886    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-6052s1c1
Sequence:CCGGCCTGCAGCTTTAGTTTACTAACTCGAGTTAGTAAACTAAAGCTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-1050s1c1
Sequence:CCGGGCTGGCGATTATGCAGATTTACTCGAGTAAATCTGCATAATCGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-5973s1c1
Sequence:CCGGGCTAACATAGACGACTTGAAACTCGAGTTTCAAGTCGTCTATGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-2572s1c1
Sequence:CCGGCCAGAGGAATTTCCAAGCATACTCGAGTATGCTTGGAAATTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000113887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_014756.2-4434s1c1
Sequence:CCGGGCACAGAACATAAGCTCCAATCTCGAGATTGGAGCTTATGTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290906    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014756.2-5973s21c1
Sequence:CCGGGCTAACATAGACGACTTGAAACTCGAGTTTCAAGTCGTCTATGTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-2572s21c1
Sequence:CCGGCCAGAGGAATTTCCAAGCATACTCGAGTATGCTTGGAAATTCCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-1050s21c1
Sequence:CCGGGCTGGCGATTATGCAGATTTACTCGAGTAAATCTGCATAATCGCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290907    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-6052s21c1
Sequence:CCGGCCTGCAGCTTTAGTTTACTAACTCGAGTTAGTAAACTAAAGCTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_014756.2-4434s21c1
Sequence:CCGGGCACAGAACATAAGCTCCAATCTCGAGATTGGAGCTTATGTTCTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029437
VALIDATED
CKAP5 MISSION shRNA Bacterial Glycerol Stock
cytoskeleton associated protein 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029437.1-6077s1c1
Sequence:CCGGGCAGCTTTAGTTACTGATCTACTCGAGTAGATCAGTAACTAAAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029437.1-5349s1c1
Sequence:CCGGCCACCTTACAATGATTGATAACTCGAGTTATCAATCATTGTAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029437.1-2740s1c1
Sequence:CCGGCGACTGAATGATTCAAACAAACTCGAGTTTGTTTGAATCATTCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029437.1-4340s1c1
Sequence:CCGGGCACACAGAATATAAACTCTACTCGAGTAGAGTTTATATTCTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029437.1-970s1c1
Sequence:CCGGGCAGATTTAGTGAAAGCATTACTCGAGTAATGCTTTCACTAAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-970s21c1
Sequence:CCGGGCAGATTTAGTGAAAGCATTACTCGAGTAATGCTTTCACTAAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-5349s21c1
Sequence:CCGGCCACCTTACAATGATTGATAACTCGAGTTATCAATCATTGTAAGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-2740s21c1
Sequence:CCGGCGACTGAATGATTCAAACAAACTCGAGTTTGTTTGAATCATTCAGTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-4340s21c1
Sequence:CCGGGCACACAGAATATAAACTCTACTCGAGTAGAGTTTATATTCTGTGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029437
VALIDATED
CKAP5 MISSION shRNA shRNA Plasmid DNA
cytoskeleton associated protein 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029437.1-6077s1c1
Sequence:CCGGGCAGCTTTAGTTACTGATCTACTCGAGTAGATCAGTAACTAAAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029437.1-5349s1c1
Sequence:CCGGCCACCTTACAATGATTGATAACTCGAGTTATCAATCATTGTAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029437.1-2740s1c1
Sequence:CCGGCGACTGAATGATTCAAACAAACTCGAGTTTGTTTGAATCATTCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029437.1-4340s1c1
Sequence:CCGGGCACACAGAATATAAACTCTACTCGAGTAGAGTTTATATTCTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029437.1-970s1c1
Sequence:CCGGGCAGATTTAGTGAAAGCATTACTCGAGTAATGCTTTCACTAAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-970s21c1
Sequence:CCGGGCAGATTTAGTGAAAGCATTACTCGAGTAATGCTTTCACTAAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-5349s21c1
Sequence:CCGGCCACCTTACAATGATTGATAACTCGAGTTATCAATCATTGTAAGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-2740s21c1
Sequence:CCGGCGACTGAATGATTCAAACAAACTCGAGTTTGTTTGAATCATTCAGTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-4340s21c1
Sequence:CCGGGCACACAGAATATAAACTCTACTCGAGTAGAGTTTATATTCTGTGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029437
VALIDATED
CKAP5 MISSION shRNA Lentiviral Transduction Particles
cytoskeleton associated protein 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091588    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029437.1-6077s1c1
Sequence:CCGGGCAGCTTTAGTTACTGATCTACTCGAGTAGATCAGTAACTAAAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029437.1-5349s1c1
Sequence:CCGGCCACCTTACAATGATTGATAACTCGAGTTATCAATCATTGTAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029437.1-2740s1c1
Sequence:CCGGCGACTGAATGATTCAAACAAACTCGAGTTTGTTTGAATCATTCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029437.1-4340s1c1
Sequence:CCGGGCACACAGAATATAAACTCTACTCGAGTAGAGTTTATATTCTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029437.1-970s1c1
Sequence:CCGGGCAGATTTAGTGAAAGCATTACTCGAGTAATGCTTTCACTAAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-970s21c1
Sequence:CCGGGCAGATTTAGTGAAAGCATTACTCGAGTAATGCTTTCACTAAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-5349s21c1
Sequence:CCGGCCACCTTACAATGATTGATAACTCGAGTTATCAATCATTGTAAGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318330    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-2740s21c1
Sequence:CCGGCGACTGAATGATTCAAACAAACTCGAGTTTGTTTGAATCATTCAGTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029437.1-4340s21c1
Sequence:CCGGGCACACAGAATATAAACTCTACTCGAGTAGAGTTTATATTCTGTGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)