EMAIL THIS PAGE TO A FRIEND

CKB

creatine kinase, brain

81 Gene Product Result for
Synonyms: B-CK CKBB
UniProtKB ID: P12277, A8K236, B2R5R4, Q2LE07, Q6FG40, Q9UC66
Gene ID:
Human(1152) Summary: The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in brain as well as in other tissues, and as a heterodimer with a similar muscle isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. A pseudogene of this gene has been characterized. [provided by RefSeq, Jul 2008]
Mouse(12709) creatine kinase, brain
Rat(24264) creatine kinase, brain
chicken(396248) creatine kinase, brain
cow(516210) creatine kinase, brain
domestic cat(101098237) creatine kinase, brain
dog(480443) creatine kinase, brain
sheep(100190977) creatine kinase, brain
Domestic Rabbit(100009085) creatine kinase, brain
naked mole-rat(101712656) creatine kinase, brain
domestic guinea pig(100735800) creatine kinase, brain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK116 Creatine Kinase Activity Assay Kit sufficient for 100 tests (Ultraviolet) human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0693 AQUA Peptide GGDDLDPNYVLSS[R] human, mouse, rat pricing
AQ0745 AQUA Peptide VLTPELYAEL[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001823 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001823 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001823 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001823 Rosetta Predictions human pricing
NM_012529 Rosetta Predictions rat pricing
NM_021273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001823 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194103 predicted 602
2 SASI_Hs01_00194104 predicted 862
3 SASI_Hs02_00332610 predicted 994
4 SASI_Hs01_00194106 predicted 721
5 SASI_Hs01_00194107 predicted 1200
6 SASI_Hs01_00194108 predicted 879
7 SASI_Hs01_00194109 predicted 370
8 SASI_Hs01_00194110 predicted 852
9 SASI_Hs01_00194111 predicted 850
10 SASI_Hs01_00194112 predicted 859
11 SASI_Hs01_00194105 predicted 1205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00097191 predicted 797
2 SASI_Rn01_00097192 predicted 1153
3 SASI_Rn01_00097193 predicted 867
4 SASI_Rn01_00097194 predicted 392
5 SASI_Rn01_00097195 predicted 334
6 SASI_Rn01_00097196 predicted 762
7 SASI_Rn01_00097197 predicted 546
8 SASI_Rn01_00097198 predicted 613
9 SASI_Rn01_00097199 predicted 324
10 SASI_Rn01_00097200 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325795 predicted 693
2 SASI_Mm01_00168985 predicted 719
3 SASI_Mm01_00168986 predicted 1119
4 SASI_Mm01_00168987 predicted 753
5 SASI_Mm01_00168988 predicted 574
6 SASI_Mm01_00168990 predicted 390
7 SASI_Mm01_00168991 predicted 214
8 SASI_Mm01_00168992 predicted 614
9 SASI_Mm02_00325796 predicted 344
10 SASI_Mm01_00168993 predicted 830
11 SASI_Mm01_00168989 predicted 697
12 SASI_Mm01_00168994 predicted 518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021273
VALIDATED
CKB MISSION shRNA Bacterial Glycerol Stock
creatine kinase, brain
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021273.4-263s21c1
Sequence:CCGGACGCCGAGCGGCTTTACTTTGCTCGAGCAAAGTAAAGCCGCTCGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021273.4-644s21c1
Sequence:CCGGTACGCGCTCAAGAGCATGACTCTCGAGAGTCATGCTCTTGAGCGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021273.4-585s21c1
Sequence:CCGGTCGAGAAGCTGGCAGTAGAAGCTCGAGCTTCTACTGCCAGCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021273.2-300s1c1
Sequence:CCGGCGACGTATTCAAGGACCTCTTCTCGAGAAGAGGTCCTTGAATACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021273.2-288s1c1
Sequence:CCGGCGAGGAGAGTTACGACGTATTCTCGAGAATACGTCGTAACTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021273.2-100s1c1
Sequence:CCGGGCCGAGGATGAGTTCCCTGATCTCGAGATCAGGGAACTCATCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021273.2-1117s1c1
Sequence:CCGGGACGGAGTGAAACTACTCATTCTCGAGAATGAGTAGTTTCACTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021273
VALIDATED
CKB MISSION shRNA shRNA Plasmid DNA
creatine kinase, brain
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021273.4-263s21c1
Sequence:CCGGACGCCGAGCGGCTTTACTTTGCTCGAGCAAAGTAAAGCCGCTCGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021273.4-644s21c1
Sequence:CCGGTACGCGCTCAAGAGCATGACTCTCGAGAGTCATGCTCTTGAGCGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021273.4-585s21c1
Sequence:CCGGTCGAGAAGCTGGCAGTAGAAGCTCGAGCTTCTACTGCCAGCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021273.2-300s1c1
Sequence:CCGGCGACGTATTCAAGGACCTCTTCTCGAGAAGAGGTCCTTGAATACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021273.2-288s1c1
Sequence:CCGGCGAGGAGAGTTACGACGTATTCTCGAGAATACGTCGTAACTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021273.2-100s1c1
Sequence:CCGGGCCGAGGATGAGTTCCCTGATCTCGAGATCAGGGAACTCATCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021273.2-1117s1c1
Sequence:CCGGGACGGAGTGAAACTACTCATTCTCGAGAATGAGTAGTTTCACTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021273
VALIDATED
CKB MISSION shRNA Lentiviral Transduction Particles
creatine kinase, brain
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021273.4-263s21c1
Sequence:CCGGACGCCGAGCGGCTTTACTTTGCTCGAGCAAAGTAAAGCCGCTCGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021273.4-644s21c1
Sequence:CCGGTACGCGCTCAAGAGCATGACTCTCGAGAGTCATGCTCTTGAGCGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419062    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021273.4-585s21c1
Sequence:CCGGTCGAGAAGCTGGCAGTAGAAGCTCGAGCTTCTACTGCCAGCTTCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_021273.2-300s1c1
Sequence:CCGGCGACGTATTCAAGGACCTCTTCTCGAGAAGAGGTCCTTGAATACGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021273.2-288s1c1
Sequence:CCGGCGAGGAGAGTTACGACGTATTCTCGAGAATACGTCGTAACTCTCCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021273.2-100s1c1
Sequence:CCGGGCCGAGGATGAGTTCCCTGATCTCGAGATCAGGGAACTCATCCTCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_021273.2-1117s1c1
Sequence:CCGGGACGGAGTGAAACTACTCATTCTCGAGAATGAGTAGTTTCACTCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001823
VALIDATED
CKB MISSION shRNA Bacterial Glycerol Stock
creatine kinase, brain
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-1204s21c1
Sequence:CCGGACCTCATGCCTGCCCAGAAATCTCGAGATTTCTGGGCAGGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-998s21c1
Sequence:CCGGGAAGTTCTCGGAGGTGCTTAACTCGAGTTAAGCACCTCCGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001823.3-853s21c1
Sequence:CCGGCCCAGATTGAAACTCTCTTCACTCGAGTGAAGAGAGTTTCAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-875s21c1
Sequence:CCGGGTCTAAGGACTATGAGTTCATCTCGAGATGAACTCATAGTCCTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001823.3-1250s21c1
Sequence:CCGGGCCCTGCTGCTTCCTAACTTACTCGAGTAAGTTAGGAAGCAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001823.3-327s21c1
Sequence:CCGGGAAGTGTTCAAGGATCTCTTCCTCGAGGAAGAGATCCTTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-598s21c1
Sequence:CCGGACTACGCGCTCAAGAGCATGACTCGAGTCATGCTCTTGAGCGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-811s1c1
Sequence:CCGGGCAACATGAAGGAGGTGTTCACTCGAGTGAACACCTCCTTCATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-722s1c1
Sequence:CCGGCCGCGGTATCTGGCACAATGACTCGAGTCATTGTGCCAGATACCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001823.3-314s1c1
Sequence:CCGGCGAGGAGTCCTACGAAGTGTTCTCGAGAACACTTCGTAGGACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-1250s1c1
Sequence:CCGGGCCCTGCTGCTTCCTAACTTACTCGAGTAAGTTAGGAAGCAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-1251s1c1
Sequence:CCGGCCCTGCTGCTTCCTAACTTATCTCGAGATAAGTTAGGAAGCAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001823.3-962s1c1
Sequence:CCGGTGTGCATATCAAGCTGCCCAACTCGAGTTGGGCAGCTTGATATGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-853s1c1
Sequence:CCGGCCCAGATTGAAACTCTCTTCACTCGAGTGAAGAGAGTTTCAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-867s1c1
Sequence:CCGGCTCTTCAAGTCTAAGGACTATCTCGAGATAGTCCTTAGACTTGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001823.3-326s1c1
Sequence:CCGGCGAAGTGTTCAAGGATCTCTTCTCGAGAAGAGATCCTTGAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001823
VALIDATED
CKB MISSION shRNA shRNA Plasmid DNA
creatine kinase, brain
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-1204s21c1
Sequence:CCGGACCTCATGCCTGCCCAGAAATCTCGAGATTTCTGGGCAGGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-998s21c1
Sequence:CCGGGAAGTTCTCGGAGGTGCTTAACTCGAGTTAAGCACCTCCGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001823.3-853s21c1
Sequence:CCGGCCCAGATTGAAACTCTCTTCACTCGAGTGAAGAGAGTTTCAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-875s21c1
Sequence:CCGGGTCTAAGGACTATGAGTTCATCTCGAGATGAACTCATAGTCCTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001823.3-1250s21c1
Sequence:CCGGGCCCTGCTGCTTCCTAACTTACTCGAGTAAGTTAGGAAGCAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001823.3-327s21c1
Sequence:CCGGGAAGTGTTCAAGGATCTCTTCCTCGAGGAAGAGATCCTTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-598s21c1
Sequence:CCGGACTACGCGCTCAAGAGCATGACTCGAGTCATGCTCTTGAGCGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-811s1c1
Sequence:CCGGGCAACATGAAGGAGGTGTTCACTCGAGTGAACACCTCCTTCATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-722s1c1
Sequence:CCGGCCGCGGTATCTGGCACAATGACTCGAGTCATTGTGCCAGATACCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001823.3-314s1c1
Sequence:CCGGCGAGGAGTCCTACGAAGTGTTCTCGAGAACACTTCGTAGGACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-1250s1c1
Sequence:CCGGGCCCTGCTGCTTCCTAACTTACTCGAGTAAGTTAGGAAGCAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-1251s1c1
Sequence:CCGGCCCTGCTGCTTCCTAACTTATCTCGAGATAAGTTAGGAAGCAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001823.3-962s1c1
Sequence:CCGGTGTGCATATCAAGCTGCCCAACTCGAGTTGGGCAGCTTGATATGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-853s1c1
Sequence:CCGGCCCAGATTGAAACTCTCTTCACTCGAGTGAAGAGAGTTTCAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-867s1c1
Sequence:CCGGCTCTTCAAGTCTAAGGACTATCTCGAGATAGTCCTTAGACTTGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001823.3-326s1c1
Sequence:CCGGCGAAGTGTTCAAGGATCTCTTCTCGAGAAGAGATCCTTGAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001823
VALIDATED
CKB MISSION shRNA Lentiviral Transduction Particles
creatine kinase, brain
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315324    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-1204s21c1
Sequence:CCGGACCTCATGCCTGCCCAGAAATCTCGAGATTTCTGGGCAGGCATGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-998s21c1
Sequence:CCGGGAAGTTCTCGGAGGTGCTTAACTCGAGTTAAGCACCTCCGAGAACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315374    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001823.3-853s21c1
Sequence:CCGGCCCAGATTGAAACTCTCTTCACTCGAGTGAAGAGAGTTTCAATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-875s21c1
Sequence:CCGGGTCTAAGGACTATGAGTTCATCTCGAGATGAACTCATAGTCCTTAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350437    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001823.3-1250s21c1
Sequence:CCGGGCCCTGCTGCTTCCTAACTTACTCGAGTAAGTTAGGAAGCAGCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356500    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001823.3-327s21c1
Sequence:CCGGGAAGTGTTCAAGGATCTCTTCCTCGAGGAAGAGATCCTTGAACACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356572    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_001823.3-598s21c1
Sequence:CCGGACTACGCGCTCAAGAGCATGACTCGAGTCATGCTCTTGAGCGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-811s1c1
Sequence:CCGGGCAACATGAAGGAGGTGTTCACTCGAGTGAACACCTCCTTCATGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-722s1c1
Sequence:CCGGCCGCGGTATCTGGCACAATGACTCGAGTCATTGTGCCAGATACCGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001823.3-314s1c1
Sequence:CCGGCGAGGAGTCCTACGAAGTGTTCTCGAGAACACTTCGTAGGACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-1250s1c1
Sequence:CCGGGCCCTGCTGCTTCCTAACTTACTCGAGTAAGTTAGGAAGCAGCAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006051    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-1251s1c1
Sequence:CCGGCCCTGCTGCTTCCTAACTTATCTCGAGATAAGTTAGGAAGCAGCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001823.3-962s1c1
Sequence:CCGGTGTGCATATCAAGCTGCCCAACTCGAGTTGGGCAGCTTGATATGCACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-853s1c1
Sequence:CCGGCCCAGATTGAAACTCTCTTCACTCGAGTGAAGAGAGTTTCAATCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_001823.3-867s1c1
Sequence:CCGGCTCTTCAAGTCTAAGGACTATCTCGAGATAGTCCTTAGACTTGAAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001823.3-326s1c1
Sequence:CCGGCGAAGTGTTCAAGGATCTCTTCTCGAGAAGAGATCCTTGAACACTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks