EMAIL THIS PAGE TO A FRIEND

CKLF

chemokine-like factor

142 Gene Product Result for
Synonyms: C32 CKLF1 CKLF2 CKLF3 CKLF4 UCK-1
UniProtKB ID: Q9UBR5, C9JE38, Q9UHM7, Q9UHN8, Q9UI41
Gene ID:
Human(51192) Summary: The product of this gene is a cytokine. Cytokines are small proteins that have an essential role in the immune and inflammatory responses. This gene is one of several chemokine-like factor genes located in a cluster on chromosome 16. The protein encoded by this gene is a potent chemoattractant for neutrophils, monocytes and lymphocytes. It also can stimulate the proliferation of skeletal muscle cells. This protein may play important roles in inflammation and in the regeneration of skeletal muscle. Alternatively spliced transcript variants encoding different isoforms have been identified. Naturally occurring read-through transcription occurs between this locus and the neighboring locus CMTM1 (CKLF-like MARVEL transmembrane domain containing 1).[provided by RefSeq, Feb 2011]
Mouse(75458) chemokine-like factor
Rat(245978) chemokine-like factor
sheep(101103916) chemokine-like factor
domestic guinea pig(100727126) chemokine-like factor
naked mole-rat(101705246) chemokine-like factor
chicken(415795) chemokine-like factor
dog(611371) chemokine-like factor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029295 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029295 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029295 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_181641 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181641 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181641 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040138 Rosetta Predictions human pricing
NM_001040139 Rosetta Predictions human pricing
NM_016326 Rosetta Predictions human pricing
NM_016951 Rosetta Predictions human pricing
NM_181640 Rosetta Predictions human pricing
NM_181641 Rosetta Predictions human pricing
NM_139111 Rosetta Predictions rat pricing
NM_001037840 Rosetta Predictions mouse pricing
NM_001037841 Rosetta Predictions mouse pricing
NM_029295 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040138 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012764 predicted 230
2 SASI_Hs01_00012765 predicted 409
3 SASI_Hs01_00012766 predicted 353
4 SASI_Hs01_00012767 predicted 269
5 SASI_Hs01_00012768 predicted 392
6 SASI_Hs01_00012769 predicted 347
7 SASI_Hs01_00012770 predicted 217
8 SASI_Hs01_00012771 predicted 430
9 SASI_Hs01_00012772 predicted 279
10 SASI_Hs02_00308851 predicted 299
11 SASI_Hs01_00012773 predicted 384
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00148875 predicted 223
2 SASI_Hs01_00148876 predicted 328
3 SASI_Hs01_00148877 predicted 211
4 SASI_Hs01_00148878 predicted 252
5 SASI_Hs01_00148879 predicted 221
6 SASI_Hs01_00148880 predicted 247
7 SASI_Hs01_00148881 predicted 335
8 SASI_Hs01_00148882 predicted 265
9 SASI_Hs01_00148883 predicted 222
10 SASI_Hs01_00148884 predicted 215
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016326 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235396 predicted 216
2 SASI_Hs01_00235397 predicted 193
3 SASI_Hs01_00235398 predicted 211
4 SASI_Hs02_00349272 predicted 261
5 SASI_Hs01_00235399 predicted 215
6 SASI_Hs02_00349273 predicted 368
7 SASI_Hs01_00235400 predicted 289
8 SASI_Hs01_00235401 predicted 372
9 SASI_Hs01_00235402 predicted 222
10 SASI_Hs01_00235403 predicted 218
11 SASI_Hs01_00235404 predicted 222
12 SASI_Hs01_00235405 predicted 274
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016951 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084799 predicted 221
2 SASI_Hs01_00084800 predicted 344
3 SASI_Hs01_00084801 predicted 345
4 SASI_Hs01_00084802 predicted 266
5 SASI_Hs01_00084803 predicted 335
6 SASI_Hs01_00084804 predicted 336
7 SASI_Hs01_00084805 predicted 340
8 SASI_Hs01_00084807 predicted 275
9 SASI_Hs01_00084808 predicted 276
10 SASI_Hs02_00349956 predicted 331
11 SASI_Hs01_00084806 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221853 predicted 208
2 SASI_Hs01_00221854 predicted 251
3 SASI_Hs01_00221855 predicted 186
4 SASI_Hs01_00221857 predicted 464
5 SASI_Hs01_00221858 predicted 359
6 SASI_Hs01_00221859 predicted 233
7 SASI_Hs01_00221861 predicted 262
8 SASI_Hs02_00370206 predicted 212
9 SASI_Hs02_00370207 predicted 250
10 SASI_Hs02_00370208 predicted 319
11 SASI_Hs01_00221852 predicted 202
12 SASI_Hs01_00221856 predicted 463
13 SASI_Hs01_00221860 predicted 284
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181641 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145673 predicted 217
2 SASI_Hs01_00145674 predicted 271
3 SASI_Hs01_00145675 predicted 224
4 SASI_Hs01_00145676 predicted 213
5 SASI_Hs01_00145678 predicted 220
6 SASI_Hs01_00145679 predicted 214
7 SASI_Hs01_00145680 predicted 217
8 SASI_Hs01_00145681 predicted 223
9 SASI_Hs01_00145682 predicted 191
10 SASI_Hs02_00370209 predicted 348
11 SASI_Hs01_00145677 predicted 209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030191 predicted 391
2 SASI_Rn01_00030192 predicted 406
3 SASI_Rn01_00030193 predicted 427
4 SASI_Rn01_00030194 predicted 388
5 SASI_Rn02_00268489 predicted 311
6 SASI_Rn01_00030196 predicted 424
7 SASI_Rn01_00030197 predicted 403
8 SASI_Rn02_00268490 predicted 387
9 SASI_Rn02_00268491 predicted 394
10 SASI_Rn01_00030199 predicted 358
11 SASI_Rn01_00030195 predicted 424
12 SASI_Rn01_00030198 predicted 417
13 SASI_Rn01_00030200 predicted 206
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037840 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178455 predicted 287
2 SASI_Mm01_00178456 predicted 209
3 SASI_Mm01_00178457 predicted 382
4 SASI_Mm01_00178458 predicted 254
5 SASI_Mm01_00178459 predicted 246
6 SASI_Mm01_00178460 predicted 449
7 SASI_Mm01_00178461 predicted 337
8 SASI_Mm01_00178462 predicted 253
9 SASI_Mm01_00178463 predicted 411
10 SASI_Mm01_00178464 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037841 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289460 predicted 539
2 SASI_Mm01_00038526 predicted 540
3 SASI_Mm02_00289461 predicted 835
4 SASI_Mm01_00038527 predicted 579
5 SASI_Mm01_00038528 predicted 689
6 SASI_Mm01_00038530 predicted 728
7 SASI_Mm01_00038531 predicted 400
8 SASI_Mm01_00038532 predicted 306
9 SASI_Mm01_00038533 predicted 383
10 SASI_Mm02_00289462 predicted 403
11 SASI_Mm01_00038525 predicted 234
12 SASI_Mm01_00038529 predicted 243
13 SASI_Mm01_00038534 predicted 285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029295 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335107 predicted 391
2 SASI_Mm01_00155136 predicted 356
3 SASI_Mm01_00155137 predicted 343
4 SASI_Mm02_00335108 predicted 342
5 SASI_Mm01_00155140 predicted 311
6 SASI_Mm01_00155141 predicted 302
7 SASI_Mm02_00335109 predicted 339
8 SASI_Mm01_00155142 predicted 364
9 SASI_Mm02_00335110 predicted 389
10 SASI_Mm02_00335111 predicted 302
11 SASI_Mm01_00155133 predicted 263
12 SASI_Mm01_00155134 predicted 327
13 SASI_Mm01_00155135 predicted 206
14 SASI_Mm01_00155138 predicted 315
15 SASI_Mm01_00155139 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029295
VALIDATED
CKLF MISSION shRNA Bacterial Glycerol Stock
chemokine-like factor
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029295.1-308s1c1
Sequence:CCGGCGTGTGGACTTGACAAGATAACTCGAGTTATCTTGTCAAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029295.1-397s1c1
Sequence:CCGGGTGTCTGTGTTGGCTCTAATACTCGAGTATTAGAGCCAACACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029295.1-307s1c1
Sequence:CCGGACGTGTGGACTTGACAAGATACTCGAGTATCTTGTCAAGTCCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029295.1-152s1c1
Sequence:CCGGCCTTCTGCTGTACTCTGAAATCTCGAGATTTCAGAGTACAGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029295.1-462s1c1
Sequence:CCGGCCTGACAGTAACATGTACTATCTCGAGATAGTACATGTTACTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-150s21c1
Sequence:CCGGCCTTCTGCTGTACTCTGAAATCTCGAGATTTCAGAGTACAGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-460s21c1
Sequence:CCGGCCTGACAGTAACATGTACTATCTCGAGATAGTACATGTTACTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-395s21c1
Sequence:CCGGGTGTCTGTGTTGGCTCTAATACTCGAGTATTAGAGCCAACACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-305s21c1
Sequence:CCGGACGTGTGGACTTGACAAGATACTCGAGTATCTTGTCAAGTCCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029295
VALIDATED
CKLF MISSION shRNA shRNA Plasmid DNA
chemokine-like factor
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029295.1-308s1c1
Sequence:CCGGCGTGTGGACTTGACAAGATAACTCGAGTTATCTTGTCAAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029295.1-397s1c1
Sequence:CCGGGTGTCTGTGTTGGCTCTAATACTCGAGTATTAGAGCCAACACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029295.1-307s1c1
Sequence:CCGGACGTGTGGACTTGACAAGATACTCGAGTATCTTGTCAAGTCCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029295.1-152s1c1
Sequence:CCGGCCTTCTGCTGTACTCTGAAATCTCGAGATTTCAGAGTACAGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029295.1-462s1c1
Sequence:CCGGCCTGACAGTAACATGTACTATCTCGAGATAGTACATGTTACTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-150s21c1
Sequence:CCGGCCTTCTGCTGTACTCTGAAATCTCGAGATTTCAGAGTACAGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-460s21c1
Sequence:CCGGCCTGACAGTAACATGTACTATCTCGAGATAGTACATGTTACTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-395s21c1
Sequence:CCGGGTGTCTGTGTTGGCTCTAATACTCGAGTATTAGAGCCAACACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-305s21c1
Sequence:CCGGACGTGTGGACTTGACAAGATACTCGAGTATCTTGTCAAGTCCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029295
VALIDATED
CKLF MISSION shRNA Lentiviral Transduction Particles
chemokine-like factor
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029295.1-308s1c1
Sequence:CCGGCGTGTGGACTTGACAAGATAACTCGAGTTATCTTGTCAAGTCCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029295.1-397s1c1
Sequence:CCGGGTGTCTGTGTTGGCTCTAATACTCGAGTATTAGAGCCAACACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029295.1-307s1c1
Sequence:CCGGACGTGTGGACTTGACAAGATACTCGAGTATCTTGTCAAGTCCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029295.1-152s1c1
Sequence:CCGGCCTTCTGCTGTACTCTGAAATCTCGAGATTTCAGAGTACAGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029295.1-462s1c1
Sequence:CCGGCCTGACAGTAACATGTACTATCTCGAGATAGTACATGTTACTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-150s21c1
Sequence:CCGGCCTTCTGCTGTACTCTGAAATCTCGAGATTTCAGAGTACAGCAGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-460s21c1
Sequence:CCGGCCTGACAGTAACATGTACTATCTCGAGATAGTACATGTTACTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327367    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-395s21c1
Sequence:CCGGGTGTCTGTGTTGGCTCTAATACTCGAGTATTAGAGCCAACACAGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327366    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029295.2-305s21c1
Sequence:CCGGACGTGTGGACTTGACAAGATACTCGAGTATCTTGTCAAGTCCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181641
VALIDATED
CKLF MISSION shRNA Bacterial Glycerol Stock
chemokine-like factor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181641.1-181s1c1
Sequence:CCGGCCCTTCTGCTTCAGTGTGAAACTCGAGTTTCACACTGAAGCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_181641.1-376s1c1
Sequence:CCGGCCTTTGCTTGTGTTTGCACTTCTCGAGAAGTGCAAACACAAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_181641.1-294s1c1
Sequence:CCGGTGGATTTGAAGTCACCGTTATCTCGAGATAACGGTGACTTCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_181641.1-349s1c1
Sequence:CCGGGATCGATTAATGAAGTGGTTACTCGAGTAACCACTTCATTAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181641.1-293s1c1
Sequence:CCGGCTGGATTTGAAGTCACCGTTACTCGAGTAACGGTGACTTCAAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-225s21c1
Sequence:CCGGGGCACTAACTGTGACATCTATCTCGAGATAGATGTCACAGTTAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-349s21c1
Sequence:CCGGGATCGATTAATGAAGTGGTTACTCGAGTAACCACTTCATTAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-294s21c1
Sequence:CCGGTGGATTTGAAGTCACCGTTATCTCGAGATAACGGTGACTTCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-181s21c1
Sequence:CCGGCCCTTCTGCTTCAGTGTGAAACTCGAGTTTCACACTGAAGCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-270s21c1
Sequence:CCGGCCCTGAACCATATATTGTTATCTCGAGATAACAATATATGGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181641
VALIDATED
CKLF MISSION shRNA shRNA Plasmid DNA
chemokine-like factor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181641.1-181s1c1
Sequence:CCGGCCCTTCTGCTTCAGTGTGAAACTCGAGTTTCACACTGAAGCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_181641.1-376s1c1
Sequence:CCGGCCTTTGCTTGTGTTTGCACTTCTCGAGAAGTGCAAACACAAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_181641.1-294s1c1
Sequence:CCGGTGGATTTGAAGTCACCGTTATCTCGAGATAACGGTGACTTCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_181641.1-349s1c1
Sequence:CCGGGATCGATTAATGAAGTGGTTACTCGAGTAACCACTTCATTAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181641.1-293s1c1
Sequence:CCGGCTGGATTTGAAGTCACCGTTACTCGAGTAACGGTGACTTCAAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-225s21c1
Sequence:CCGGGGCACTAACTGTGACATCTATCTCGAGATAGATGTCACAGTTAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-349s21c1
Sequence:CCGGGATCGATTAATGAAGTGGTTACTCGAGTAACCACTTCATTAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-294s21c1
Sequence:CCGGTGGATTTGAAGTCACCGTTATCTCGAGATAACGGTGACTTCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-181s21c1
Sequence:CCGGCCCTTCTGCTTCAGTGTGAAACTCGAGTTTCACACTGAAGCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-270s21c1
Sequence:CCGGCCCTGAACCATATATTGTTATCTCGAGATAACAATATATGGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181641
VALIDATED
CKLF MISSION shRNA Lentiviral Transduction Particles
chemokine-like factor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181641.1-181s1c1
Sequence:CCGGCCCTTCTGCTTCAGTGTGAAACTCGAGTTTCACACTGAAGCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_181641.1-376s1c1
Sequence:CCGGCCTTTGCTTGTGTTTGCACTTCTCGAGAAGTGCAAACACAAGCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072576    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_181641.1-294s1c1
Sequence:CCGGTGGATTTGAAGTCACCGTTATCTCGAGATAACGGTGACTTCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072577    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_181641.1-349s1c1
Sequence:CCGGGATCGATTAATGAAGTGGTTACTCGAGTAACCACTTCATTAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_181641.1-293s1c1
Sequence:CCGGCTGGATTTGAAGTCACCGTTACTCGAGTAACGGTGACTTCAAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-225s21c1
Sequence:CCGGGGCACTAACTGTGACATCTATCTCGAGATAGATGTCACAGTTAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-349s21c1
Sequence:CCGGGATCGATTAATGAAGTGGTTACTCGAGTAACCACTTCATTAATCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286132    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-294s21c1
Sequence:CCGGTGGATTTGAAGTCACCGTTATCTCGAGATAACGGTGACTTCAAATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-181s21c1
Sequence:CCGGCCCTTCTGCTTCAGTGTGAAACTCGAGTTTCACACTGAAGCAGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_181641.1-270s21c1
Sequence:CCGGCCCTGAACCATATATTGTTATCTCGAGATAACAATATATGGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks