EMAIL THIS PAGE TO A FRIEND

CKM

creatine kinase, muscle

67 Gene Product Result for
Synonyms: CKMM M-CK
UniProtKB ID: P06732, Q96QL9
Gene ID:
Human(1158) Summary: The protein encoded by this gene is a cytoplasmic enzyme involved in energy homeostasis and is an important serum marker for myocardial infarction. The encoded protein reversibly catalyzes the transfer of phosphate between ATP and various phosphogens such as creatine phosphate. It acts as a homodimer in striated muscle as well as in other tissues, and as a heterodimer with a similar brain isozyme in heart. The encoded protein is a member of the ATP:guanido phosphotransferase protein family. [provided by RefSeq, Jul 2008]
Mouse(12715) creatine kinase, muscle
Rat(24265) creatine kinase, muscle
domestic guinea pig(100733577) creatine kinase, muscle
naked mole-rat(101696521) creatine kinase, muscle
sheep(101112841) creatine kinase, muscle
Domestic Rabbit(100009056) creatine kinase, muscle
chicken(396507) creatine kinase, muscle
domestic cat(101095936) creatine kinase, muscle
cow(286822) creatine kinase, muscle
dog(476435) creatine kinase, muscle
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Kits

Product # Description Species Add to Cart
 
MAK116 Creatine Kinase Activity Assay Kit sufficient for 100 tests (Ultraviolet) human, mouse, rat pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0693 AQUA Peptide GGDDLDPNYVLSS[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007710 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007710 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007710 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001824 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001824 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001824 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU006651 MISSION® esiRNA esiRNA targeting human CKM (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001824 Rosetta Predictions human pricing
NM_012530 Rosetta Predictions rat pricing
NM_007710 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001824 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045649 predicted 204
2 SASI_Hs01_00045642 predicted 708
3 SASI_Hs01_00045643 predicted 378
4 SASI_Hs01_00045644 predicted 377
5 SASI_Hs01_00045645 predicted 433
6 SASI_Hs01_00045646 predicted 535
7 SASI_Hs01_00045647 predicted 1275
8 SASI_Hs01_00045648 predicted 1142
9 SASI_Hs01_00045650 predicted 212
10 SASI_Hs02_00332611 predicted 76
11 SASI_Hs01_00045651 predicted 1403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053068 predicted 1131
2 SASI_Rn01_00053069 predicted 1125
3 SASI_Rn01_00053070 predicted 562
4 SASI_Rn01_00053071 predicted 762
5 SASI_Rn01_00053072 predicted 1126
6 SASI_Rn01_00053073 predicted 358
7 SASI_Rn02_00259605 predicted 354
8 SASI_Rn01_00053074 predicted 1061
9 SASI_Rn01_00053076 predicted 713
10 SASI_Rn01_00053077 predicted 293
11 SASI_Rn01_00053075 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007710 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064341 predicted 480
2 SASI_Mm01_00064342 predicted 591
3 SASI_Mm01_00064343 predicted 472
4 SASI_Mm01_00064344 predicted 310
5 SASI_Mm01_00064345 predicted 366
6 SASI_Mm01_00064346 predicted 565
7 SASI_Mm01_00064347 predicted 583
8 SASI_Mm01_00064348 predicted 958
9 SASI_Mm01_00064349 predicted 713
10 SASI_Mm01_00064350 predicted 599
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007710
CKM MISSION shRNA Bacterial Glycerol Stock
creatine kinase, muscle
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-186s21c1
Sequence:CCGGCTACAATAAGCTTCGCGATAACTCGAGTTATCGCGAAGCTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-372s21c1
Sequence:CCGGCAAACCCACAGACAAGCATAACTCGAGTTATGCTTGTCTGTGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-721s21c1
Sequence:CCGGATCTGGCACAACGACAACAAACTCGAGTTTGTTGTCGTTGTGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-1131s21c1
Sequence:CCGGGGTGGATGGCGTGAAGCTTATCTCGAGATAAGCTTCACGCCATCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-178s1c1
Sequence:CCGGCCTGACCTCTACAATAAGCTTCTCGAGAAGCTTATTGTAGAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-800s1c1
Sequence:CCGGGAGGCAATATGAAGGAGGTTTCTCGAGAAACCTCCTTCATATTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-720s1c1
Sequence:CCGGCATCTGGCACAACGACAACAACTCGAGTTGTTGTCGTTGTGCCAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-147s1c1
Sequence:CCGGGCACAACAATCACATGGCCAACTCGAGTTGGCCATGTGATTGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-573s1c1
Sequence:CCGGCGAGTTCAAGGGCAAGTACTACTCGAGTAGTACTTGCCCTTGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007710
CKM MISSION shRNA shRNA Plasmid DNA
creatine kinase, muscle
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-186s21c1
Sequence:CCGGCTACAATAAGCTTCGCGATAACTCGAGTTATCGCGAAGCTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-372s21c1
Sequence:CCGGCAAACCCACAGACAAGCATAACTCGAGTTATGCTTGTCTGTGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-721s21c1
Sequence:CCGGATCTGGCACAACGACAACAAACTCGAGTTTGTTGTCGTTGTGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-1131s21c1
Sequence:CCGGGGTGGATGGCGTGAAGCTTATCTCGAGATAAGCTTCACGCCATCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-178s1c1
Sequence:CCGGCCTGACCTCTACAATAAGCTTCTCGAGAAGCTTATTGTAGAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-800s1c1
Sequence:CCGGGAGGCAATATGAAGGAGGTTTCTCGAGAAACCTCCTTCATATTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-720s1c1
Sequence:CCGGCATCTGGCACAACGACAACAACTCGAGTTGTTGTCGTTGTGCCAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-147s1c1
Sequence:CCGGGCACAACAATCACATGGCCAACTCGAGTTGGCCATGTGATTGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-573s1c1
Sequence:CCGGCGAGTTCAAGGGCAAGTACTACTCGAGTAGTACTTGCCCTTGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007710
CKM MISSION shRNA Lentiviral Transduction Particles
creatine kinase, muscle
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-186s21c1
Sequence:CCGGCTACAATAAGCTTCGCGATAACTCGAGTTATCGCGAAGCTTATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-372s21c1
Sequence:CCGGCAAACCCACAGACAAGCATAACTCGAGTTATGCTTGTCTGTGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361093    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-721s21c1
Sequence:CCGGATCTGGCACAACGACAACAAACTCGAGTTTGTTGTCGTTGTGCCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007710.2-1131s21c1
Sequence:CCGGGGTGGATGGCGTGAAGCTTATCTCGAGATAAGCTTCACGCCATCCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-178s1c1
Sequence:CCGGCCTGACCTCTACAATAAGCTTCTCGAGAAGCTTATTGTAGAGGTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025428    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-800s1c1
Sequence:CCGGGAGGCAATATGAAGGAGGTTTCTCGAGAAACCTCCTTCATATTGCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-720s1c1
Sequence:CCGGCATCTGGCACAACGACAACAACTCGAGTTGTTGTCGTTGTGCCAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-147s1c1
Sequence:CCGGGCACAACAATCACATGGCCAACTCGAGTTGGCCATGTGATTGTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007710.1-573s1c1
Sequence:CCGGCGAGTTCAAGGGCAAGTACTACTCGAGTAGTACTTGCCCTTGAACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001824
CKM MISSION shRNA Bacterial Glycerol Stock
creatine kinase, muscle
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-165s1c1
Sequence:CCGGGCCAAGGTACTGACCCTTGAACTCGAGTTCAAGGGTCAGTACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001824.2-1347s1c1
Sequence:CCGGCCTTCTCAGAGTTCCAGTTTCCTCGAGGAAACTGGAACTCTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-1184s1c1
Sequence:CCGGCCAGTCCATTGACGACATGATCTCGAGATCATGTCGTCAATGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-576s1c1
Sequence:CCGGGAGTTCAAAGGGAAGTACTACCTCGAGGTAGTACTTCCCTTTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001824.2-1399s1c1
Sequence:CCGGCTGGATTCTGGCCAATGAAATCTCGAGATTTCATTGGCCAGAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-642s1c1
Sequence:CCGGGACCACTTCCTGTTCGACAAGCTCGAGCTTGTCGAACAGGAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-1105s1c1
Sequence:CCGGCGTCCGAAGTAGAACAGGTGCCTCGAGGCACCTGTTCTACTTCGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-371s1c1
Sequence:CCGGCTACAAACCCACTGACAAGCACTCGAGTGCTTGTCAGTGGGTTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-726s1c1
Sequence:CCGGTGGCACAATGACAACAAGAGCCTCGAGGCTCTTGTTGTCATTGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-223s1c1
Sequence:CCGGGCTTCACTGTAGACGATGTCACTCGAGTGACATCGTCTACAGTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001824
CKM MISSION shRNA shRNA Plasmid DNA
creatine kinase, muscle
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-165s1c1
Sequence:CCGGGCCAAGGTACTGACCCTTGAACTCGAGTTCAAGGGTCAGTACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001824.2-1347s1c1
Sequence:CCGGCCTTCTCAGAGTTCCAGTTTCCTCGAGGAAACTGGAACTCTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-1184s1c1
Sequence:CCGGCCAGTCCATTGACGACATGATCTCGAGATCATGTCGTCAATGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-576s1c1
Sequence:CCGGGAGTTCAAAGGGAAGTACTACCTCGAGGTAGTACTTCCCTTTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001824.2-1399s1c1
Sequence:CCGGCTGGATTCTGGCCAATGAAATCTCGAGATTTCATTGGCCAGAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-642s1c1
Sequence:CCGGGACCACTTCCTGTTCGACAAGCTCGAGCTTGTCGAACAGGAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-1105s1c1
Sequence:CCGGCGTCCGAAGTAGAACAGGTGCCTCGAGGCACCTGTTCTACTTCGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-371s1c1
Sequence:CCGGCTACAAACCCACTGACAAGCACTCGAGTGCTTGTCAGTGGGTTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-726s1c1
Sequence:CCGGTGGCACAATGACAACAAGAGCCTCGAGGCTCTTGTTGTCATTGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-223s1c1
Sequence:CCGGGCTTCACTGTAGACGATGTCACTCGAGTGACATCGTCTACAGTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001824
CKM MISSION shRNA Lentiviral Transduction Particles
creatine kinase, muscle
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-165s1c1
Sequence:CCGGGCCAAGGTACTGACCCTTGAACTCGAGTTCAAGGGTCAGTACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195354    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001824.2-1347s1c1
Sequence:CCGGCCTTCTCAGAGTTCCAGTTTCCTCGAGGAAACTGGAACTCTGAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-1184s1c1
Sequence:CCGGCCAGTCCATTGACGACATGATCTCGAGATCATGTCGTCAATGGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197275    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-576s1c1
Sequence:CCGGGAGTTCAAAGGGAAGTACTACCTCGAGGTAGTACTTCCCTTTGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195689    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001824.2-1399s1c1
Sequence:CCGGCTGGATTCTGGCCAATGAAATCTCGAGATTTCATTGGCCAGAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199607    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.2-642s1c1
Sequence:CCGGGACCACTTCCTGTTCGACAAGCTCGAGCTTGTCGAACAGGAAGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-1105s1c1
Sequence:CCGGCGTCCGAAGTAGAACAGGTGCCTCGAGGCACCTGTTCTACTTCGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-371s1c1
Sequence:CCGGCTACAAACCCACTGACAAGCACTCGAGTGCTTGTCAGTGGGTTTGTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-726s1c1
Sequence:CCGGTGGCACAATGACAACAAGAGCCTCGAGGCTCTTGTTGTCATTGTGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001824.x-223s1c1
Sequence:CCGGGCTTCACTGTAGACGATGTCACTCGAGTGACATCGTCTACAGTGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks