EMAIL THIS PAGE TO A FRIEND

CKMT1B

creatine kinase, mitochondrial 1B

44 Gene Product Result for
Synonyms: CKMT CKMT1 UMTCK
Gene ID:
Human(1159) Summary: Mitochondrial creatine (MtCK) kinase is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK and ubiquitous MtCK, encoded by separate genes. Mitochondrial creatine kinase occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Many malignant cancers with poor prognosis have shown overexpression of ubiquitous mitochondrial creatine kinase; this may be related to high energy turnover and failure to eliminate cancer cells via apoptosis. Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric mitochondrial creatine kinase. Two genes located near each other on chromosome 15 have been identified which encode identical mitochondrial creatine kinase proteins. [provided by RefSeq, Jul 2008]
Rat(29593) creatine kinase, mitochondrial 1B
cow(281692) creatine kinase, mitochondrial 1B
Horse(100056283) creatine kinase, mitochondrial 1B
dog(478277) creatine kinase, mitochondrial 1B
domestic cat(101097983) creatine kinase, mitochondrial 1B
naked mole-rat(101725224) creatine kinase, mitochondrial 1B
sheep(101108520) creatine kinase, mitochondrial 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020990 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020990 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020990 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111571 MISSION® esiRNA esiRNA human CKMT1A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020990 Rosetta Predictions human pricing
NM_001012738 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020990 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161839 predicted 816
2 SASI_Hs02_00354450 predicted 811
3 SASI_Hs01_00161840 predicted 935
4 SASI_Hs01_00161841 predicted 984
5 SASI_Hs01_00161844 predicted 1042
6 SASI_Hs01_00161845 predicted 1174
7 SASI_Hs02_00354451 predicted 627
8 SASI_Hs01_00161847 predicted 762
9 SASI_Hs01_00161848 predicted 907
10 SASI_Hs02_00354452 predicted 635
11 SASI_Hs01_00161842 predicted 1133
12 SASI_Hs01_00161843 predicted 740
13 SASI_Hs01_00161846 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012738 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038449 predicted 691
2 SASI_Rn01_00038450 predicted 807
3 SASI_Rn01_00038451 predicted 275
4 SASI_Rn01_00038453 predicted 594
5 SASI_Rn01_00038454 predicted 1299
6 SASI_Rn01_00038455 predicted 537
7 SASI_Rn01_00038456 predicted 850
8 SASI_Rn01_00038457 predicted 563
9 SASI_Rn02_00200597 predicted 369
10 SASI_Rn01_00038458 predicted 760
11 SASI_Rn01_00038452 predicted 1116
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020990
VALIDATED
CKMT1B MISSION shRNA Bacterial Glycerol Stock
creatine kinase, mitochondrial 1B
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-1314s1c1
Sequence:CCGGGAGCGTTTGGGATACATCTTGCTCGAGCAAGATGTATCCCAAACGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-561s1c1
Sequence:CCGGCGAAAGCACAACAACTGCATGCTCGAGCATGCAGTTGTTGTGCTTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-1571s1c1
Sequence:CCGGGATTGATTGTGAACGGCGTCTCTCGAGAGACGCCGTTCACAATCAATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-774s1c1
Sequence:CCGGGAGCGACACAATGGATATGACCTCGAGGTCATATCCATTGTGTCGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020990.2-536s1c1
Sequence:CCGGGTGATCCAAGAGCGACACAATCTCGAGATTGTGTCGCTCTTGGATCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020990.2-1255s1c1
Sequence:CCGGCGGTGTCTTTGATATTTCTAACTCGAGTTAGAAATATCAAAGACACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020990.2-1165s1c1
Sequence:CCGGGCTAAGCAAAGATAGCCGCTTCTCGAGAAGCGGCTATCTTTGCTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020990.2-905s1c1
Sequence:CCGGCGTGGAATTTGGCACAACAATCTCGAGATTGTTGTGCCAAATTCCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020990.2-806s1c1
Sequence:CCGGGCTGAACAGCAGCAGCTTATTCTCGAGAATAAGCTGCTGCTGTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-942s1c1
Sequence:UNK
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020990
VALIDATED
CKMT1B MISSION shRNA shRNA Plasmid DNA
creatine kinase, mitochondrial 1B
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-1314s1c1
Sequence:CCGGGAGCGTTTGGGATACATCTTGCTCGAGCAAGATGTATCCCAAACGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-561s1c1
Sequence:CCGGCGAAAGCACAACAACTGCATGCTCGAGCATGCAGTTGTTGTGCTTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-1571s1c1
Sequence:CCGGGATTGATTGTGAACGGCGTCTCTCGAGAGACGCCGTTCACAATCAATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-774s1c1
Sequence:CCGGGAGCGACACAATGGATATGACCTCGAGGTCATATCCATTGTGTCGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020990.2-536s1c1
Sequence:CCGGGTGATCCAAGAGCGACACAATCTCGAGATTGTGTCGCTCTTGGATCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020990.2-1255s1c1
Sequence:CCGGCGGTGTCTTTGATATTTCTAACTCGAGTTAGAAATATCAAAGACACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020990.2-1165s1c1
Sequence:CCGGGCTAAGCAAAGATAGCCGCTTCTCGAGAAGCGGCTATCTTTGCTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020990.2-905s1c1
Sequence:CCGGCGTGGAATTTGGCACAACAATCTCGAGATTGTTGTGCCAAATTCCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020990.2-806s1c1
Sequence:CCGGGCTGAACAGCAGCAGCTTATTCTCGAGAATAAGCTGCTGCTGTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000204913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-942s1c1
Sequence:UNK
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020990
VALIDATED
CKMT1B MISSION shRNA Lentiviral Transduction Particles
creatine kinase, mitochondrial 1B
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197251    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-1314s1c1
Sequence:CCGGGAGCGTTTGGGATACATCTTGCTCGAGCAAGATGTATCCCAAACGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195676    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-561s1c1
Sequence:CCGGCGAAAGCACAACAACTGCATGCTCGAGCATGCAGTTGTTGTGCTTTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-1571s1c1
Sequence:CCGGGATTGATTGTGAACGGCGTCTCTCGAGAGACGCCGTTCACAATCAATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196923    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-774s1c1
Sequence:CCGGGAGCGACACAATGGATATGACCTCGAGGTCATATCCATTGTGTCGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006058    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_020990.2-536s1c1
Sequence:CCGGGTGATCCAAGAGCGACACAATCTCGAGATTGTGTCGCTCTTGGATCACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020990.2-1255s1c1
Sequence:CCGGCGGTGTCTTTGATATTTCTAACTCGAGTTAGAAATATCAAAGACACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006059    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_020990.2-1165s1c1
Sequence:CCGGGCTAAGCAAAGATAGCCGCTTCTCGAGAAGCGGCTATCTTTGCTTAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_020990.2-905s1c1
Sequence:CCGGCGTGGAATTTGGCACAACAATCTCGAGATTGTTGTGCCAAATTCCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006057    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020990.2-806s1c1
Sequence:CCGGGCTGAACAGCAGCAGCTTATTCTCGAGAATAAGCTGCTGCTGTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000204913    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020990.3-942s1c1
Sequence:UNK
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)