EMAIL THIS PAGE TO A FRIEND

CKMT2

creatine kinase, mitochondrial 2 (sarcomeric)

86 Gene Product Result for
Synonyms: SMTCK
UniProtKB ID: P17540, Q6ICS8, Q8N1E1
Gene ID:
Human(1160) Summary: Mitochondrial creatine kinase (MtCK) is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK and ubiquitous MtCK, encoded by separate genes. Mitochondrial creatine kinase occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Sarcomeric mitochondrial creatine kinase has 80% homology with the coding exons of ubiquitous mitochondrial creatine kinase. This gene contains sequences homologous to several motifs that are shared among some nuclear genes encoding mitochondrial proteins and thus may be essential for the coordinated activation of these genes during mitochondrial biogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(76722) creatine kinase, mitochondrial 2
Rat(688698) creatine kinase, mitochondrial 2, sarcomeric
sheep(101122189) creatine kinase, mitochondrial 2 (sarcomeric)
naked mole-rat(101703096) creatine kinase, mitochondrial 2 (sarcomeric)
domestic guinea pig(100723785) creatine kinase, mitochondrial 2 (sarcomeric)
Zebrafish(799492) creatine kinase, mitochondrial 2 (sarcomeric)
chicken(396508) creatine kinase, mitochondrial 2 (sarcomeric)
cow(538944) creatine kinase, mitochondrial 2 (sarcomeric)
domestic cat(101088213) creatine kinase, mitochondrial 2 (sarcomeric)
dog(479163) creatine kinase, mitochondrial 2 (sarcomeric)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001825 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001825 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001825 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001099735 Rosetta Predictions human pricing
NM_001099736 Rosetta Predictions human pricing
NM_001825 Rosetta Predictions human pricing
NM_001127652 Rosetta Predictions rat pricing
NM_198415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321203 predicted 533
2 SASI_Hs02_00321204 predicted 906
3 SASI_Hs02_00321205 predicted 1243
4 SASI_Hs02_00321206 predicted 883
5 SASI_Hs02_00321207 predicted 1064
6 SASI_Hs02_00321208 predicted 839
7 SASI_Hs02_00321209 predicted 866
8 SASI_Hs02_00321210 predicted 927
9 SASI_Hs02_00321211 predicted 1174
10 SASI_Hs02_00321212 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321213 predicted 535
2 SASI_Hs02_00321214 predicted 911
3 SASI_Hs02_00321215 predicted 1250
4 SASI_Hs02_00321216 predicted 880
5 SASI_Hs02_00321217 predicted 1065
6 SASI_Hs02_00321218 predicted 849
7 SASI_Hs02_00321219 predicted 869
8 SASI_Hs02_00321220 predicted 932
9 SASI_Hs02_00321221 predicted 1180
10 SASI_Hs02_00321222 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001825 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332612 predicted 692
2 SASI_Hs01_00095118 predicted 1067
3 SASI_Hs02_00332613 predicted 1408
4 SASI_Hs02_00332614 predicted 1045
5 SASI_Hs01_00095121 predicted 1227
6 SASI_Hs01_00095122 predicted 1007
7 SASI_Hs02_00332615 predicted 1028
8 SASI_Hs02_00332616 predicted 1093
9 SASI_Hs02_00332617 predicted 1342
10 SASI_Hs01_00095126 predicted 1077
11 SASI_Hs01_00095119 predicted 230
12 SASI_Hs01_00095120 predicted 338
13 SASI_Hs01_00095123 predicted 1113
14 SASI_Hs01_00095124 predicted 1036
15 SASI_Hs01_00095125 predicted 224
16 SASI_Hs01_00095127 predicted 1367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127652 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254760 predicted 417
2 SASI_Rn02_00254761 predicted 873
3 SASI_Rn02_00254762 predicted 384
4 SASI_Rn02_00254763 predicted 812
5 SASI_Rn02_00254764 predicted 959
6 SASI_Rn02_00254765 predicted 657
7 SASI_Rn02_00254766 predicted 1030
8 SASI_Rn02_00254767 predicted 438
9 SASI_Rn02_00254768 predicted 500
10 SASI_Rn02_00254769 predicted 781
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082640 predicted 910
2 SASI_Mm01_00082641 predicted 997
3 SASI_Mm01_00082642 predicted 1206
4 SASI_Mm01_00082643 predicted 1249
5 SASI_Mm01_00082644 predicted 1179
6 SASI_Mm01_00082645 predicted 692
7 SASI_Mm01_00082646 predicted 848
8 SASI_Mm01_00082647 predicted 536
9 SASI_Mm01_00082648 predicted 832
10 SASI_Mm01_00082649 predicted 910
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198415
CKMT2 MISSION shRNA Bacterial Glycerol Stock
creatine kinase, mitochondrial 2 (sarcomeric)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-939s21c1
Sequence:CCGGGAGATTCTGTCGTGGACTAAACTCGAGTTTAGTCCACGACAGAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-916s21c1
Sequence:CCGGGGCAATATGAAACGCGTATTTCTCGAGAAATACGCGTTTCATATTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-1007s21c1
Sequence:CCGGATGAGCGTCTGGGATACATTTCTCGAGAAATGTATCCCAGACGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-1176s21c1
Sequence:CCGGGGCAGATGTGTACGATATTTCCTCGAGGAAATATCGTACACATCTGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-890s1c1
Sequence:CCGGCCAGGGTGATCTCAATGGAAACTCGAGTTTCCATTGAGATCACCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-1183s1c1
Sequence:CCGGGTGTACGATATTTCCAACATACTCGAGTATGTTGGAAATATCGTACACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-164s1c1
Sequence:CCGGCCACTGGTTACCTGCTGAATACTCGAGTATTCAGCAGGTAACCAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-955s1c1
Sequence:CCGGCTAAAGGAAGTGGAACGATTACTCGAGTAATCGTTCCACTTCCTTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198415
CKMT2 MISSION shRNA shRNA Plasmid DNA
creatine kinase, mitochondrial 2 (sarcomeric)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-939s21c1
Sequence:CCGGGAGATTCTGTCGTGGACTAAACTCGAGTTTAGTCCACGACAGAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-916s21c1
Sequence:CCGGGGCAATATGAAACGCGTATTTCTCGAGAAATACGCGTTTCATATTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-1007s21c1
Sequence:CCGGATGAGCGTCTGGGATACATTTCTCGAGAAATGTATCCCAGACGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-1176s21c1
Sequence:CCGGGGCAGATGTGTACGATATTTCCTCGAGGAAATATCGTACACATCTGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-890s1c1
Sequence:CCGGCCAGGGTGATCTCAATGGAAACTCGAGTTTCCATTGAGATCACCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-1183s1c1
Sequence:CCGGGTGTACGATATTTCCAACATACTCGAGTATGTTGGAAATATCGTACACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-164s1c1
Sequence:CCGGCCACTGGTTACCTGCTGAATACTCGAGTATTCAGCAGGTAACCAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-955s1c1
Sequence:CCGGCTAAAGGAAGTGGAACGATTACTCGAGTAATCGTTCCACTTCCTTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198415
CKMT2 MISSION shRNA Lentiviral Transduction Particles
creatine kinase, mitochondrial 2 (sarcomeric)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360828    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-939s21c1
Sequence:CCGGGAGATTCTGTCGTGGACTAAACTCGAGTTTAGTCCACGACAGAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-916s21c1
Sequence:CCGGGGCAATATGAAACGCGTATTTCTCGAGAAATACGCGTTTCATATTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360755    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-1007s21c1
Sequence:CCGGATGAGCGTCTGGGATACATTTCTCGAGAAATGTATCCCAGACGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360754    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198415.2-1176s21c1
Sequence:CCGGGGCAGATGTGTACGATATTTCCTCGAGGAAATATCGTACACATCTGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-890s1c1
Sequence:CCGGCCAGGGTGATCTCAATGGAAACTCGAGTTTCCATTGAGATCACCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024565    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-1183s1c1
Sequence:CCGGGTGTACGATATTTCCAACATACTCGAGTATGTTGGAAATATCGTACACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-164s1c1
Sequence:CCGGCCACTGGTTACCTGCTGAATACTCGAGTATTCAGCAGGTAACCAGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198415.1-955s1c1
Sequence:CCGGCTAAAGGAAGTGGAACGATTACTCGAGTAATCGTTCCACTTCCTTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001825
CKMT2 MISSION shRNA Bacterial Glycerol Stock
creatine kinase, mitochondrial 2 (sarcomeric)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.2-1400s1c1
Sequence:CCGGAGTCATCGATGGAGTCAATTACTCGAGTAATTGACTCCATCGATGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.2-1165s1c1
Sequence:CCGGATGAGCGCCTAGGATACATTTCTCGAGAAATGTATCCTAGGCGCTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.2-669s1c1
Sequence:CCGGACGGATCTGGATGCATCAAAGCTCGAGCTTTGATGCATCCAGATCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-406s1c1
Sequence:CCGGCCCGCCATTTATTCCAAGCTTCTCGAGAAGCTTGGAATAAATGGCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-1004s1c1
Sequence:CCGGCCAGGGTAATCTCAATGGAAACTCGAGTTTCCATTGAGATTACCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-573s1c1
Sequence:CCGGCGTCATCAAACTAAGACACAACTCGAGTTGTGTCTTAGTTTGATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-1038s1c1
Sequence:CCGGGAAACGAGTATTTGAGCGATTCTCGAGAATCGCTCAAATACTCGTTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-1288s1c1
Sequence:CCGGGTCGCAGATGTGTACGACATTCTCGAGAATGTCGTACACATCTGCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.1-300s1c1
Sequence:CCGGGCAGAAAGTGTGTGCCGAGGTCTCGAGACCTCGGCACACACTTTCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.1-868s1c1
Sequence:CCGGGACCACTTTCTGTTTGATAAGCTCGAGCTTATCAAACAGAAAGTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.1-1081s1c1
Sequence:CCGGGAACGGTTAATCCAAGAACGACTCGAGTCGTTCTTGGATTAACCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001825
CKMT2 MISSION shRNA shRNA Plasmid DNA
creatine kinase, mitochondrial 2 (sarcomeric)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.2-1400s1c1
Sequence:CCGGAGTCATCGATGGAGTCAATTACTCGAGTAATTGACTCCATCGATGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.2-1165s1c1
Sequence:CCGGATGAGCGCCTAGGATACATTTCTCGAGAAATGTATCCTAGGCGCTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.2-669s1c1
Sequence:CCGGACGGATCTGGATGCATCAAAGCTCGAGCTTTGATGCATCCAGATCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-406s1c1
Sequence:CCGGCCCGCCATTTATTCCAAGCTTCTCGAGAAGCTTGGAATAAATGGCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-1004s1c1
Sequence:CCGGCCAGGGTAATCTCAATGGAAACTCGAGTTTCCATTGAGATTACCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-573s1c1
Sequence:CCGGCGTCATCAAACTAAGACACAACTCGAGTTGTGTCTTAGTTTGATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-1038s1c1
Sequence:CCGGGAAACGAGTATTTGAGCGATTCTCGAGAATCGCTCAAATACTCGTTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-1288s1c1
Sequence:CCGGGTCGCAGATGTGTACGACATTCTCGAGAATGTCGTACACATCTGCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.1-300s1c1
Sequence:CCGGGCAGAAAGTGTGTGCCGAGGTCTCGAGACCTCGGCACACACTTTCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.1-868s1c1
Sequence:CCGGGACCACTTTCTGTTTGATAAGCTCGAGCTTATCAAACAGAAAGTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.1-1081s1c1
Sequence:CCGGGAACGGTTAATCCAAGAACGACTCGAGTCGTTCTTGGATTAACCGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001825
CKMT2 MISSION shRNA Lentiviral Transduction Particles
creatine kinase, mitochondrial 2 (sarcomeric)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.2-1400s1c1
Sequence:CCGGAGTCATCGATGGAGTCAATTACTCGAGTAATTGACTCCATCGATGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.2-1165s1c1
Sequence:CCGGATGAGCGCCTAGGATACATTTCTCGAGAAATGTATCCTAGGCGCTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219735    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.2-669s1c1
Sequence:CCGGACGGATCTGGATGCATCAAAGCTCGAGCTTTGATGCATCCAGATCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-406s1c1
Sequence:CCGGCCCGCCATTTATTCCAAGCTTCTCGAGAAGCTTGGAATAAATGGCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-1004s1c1
Sequence:CCGGCCAGGGTAATCTCAATGGAAACTCGAGTTTCCATTGAGATTACCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-573s1c1
Sequence:CCGGCGTCATCAAACTAAGACACAACTCGAGTTGTGTCTTAGTTTGATGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-1038s1c1
Sequence:CCGGGAAACGAGTATTTGAGCGATTCTCGAGAATCGCTCAAATACTCGTTTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001825.1-1288s1c1
Sequence:CCGGGTCGCAGATGTGTACGACATTCTCGAGAATGTCGTACACATCTGCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.1-300s1c1
Sequence:CCGGGCAGAAAGTGTGTGCCGAGGTCTCGAGACCTCGGCACACACTTTCTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196397    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.1-868s1c1
Sequence:CCGGGACCACTTTCTGTTTGATAAGCTCGAGCTTATCAAACAGAAAGTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196618    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001825.1-1081s1c1
Sequence:CCGGGAACGGTTAATCCAAGAACGACTCGAGTCGTTCTTGGATTAACCGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)