EMAIL THIS PAGE TO A FRIEND

CKS1B

CDC28 protein kinase regulatory subunit 1B

98 Gene Product Result for
Synonyms: CKS1 PNAS-16 PNAS-18 ckshs1
UniProtKB ID: P61024, P33551
Gene ID:
Human(1163) Summary: CKS1B protein binds to the catalytic subunit of the cyclin dependent kinases and is essential for their biological function. The CKS1B mRNA is found to be expressed in different patterns through the cell cycle in HeLa cells, which reflects a specialized role for the encoded protein. At least two transcript variants have been identified for this gene, and it appears that only one of them encodes a protein. [provided by RefSeq, Sep 2008]
Mouse(54124) CDC28 protein kinase 1b
Rat(499655) CDC28 protein kinase regulatory subunit 1B
Zebrafish(445199) CDC28 protein kinase regulatory subunit 1B
cow(615827) CDC28 protein kinase regulatory subunit 1B
domestic cat(101092660) CDC28 protein kinase regulatory subunit 1B
dog(612237) CDC28 protein kinase regulatory subunit 1B
chicken(100134845) CDC28 protein kinase regulatory subunit 1B
sheep(101113974) CDC28 protein kinase regulatory subunit 1B
domestic guinea pig(100735024) CDC28 protein kinase regulatory subunit 1B
naked mole-rat(101717087) CDC28 protein kinase regulatory subunit 1B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001826 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001826 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001826 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU093551 MISSION® esiRNA esiRNA targeting mouse Cks1b (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001826 Rosetta Predictions human pricing
XM_579997 Rosetta Predictions rat pricing
NM_016904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001826 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332618 predicted 487
2 SASI_Hs02_00332619 predicted 380
3 SASI_Hs02_00332620 predicted 289
4 SASI_Hs02_00332621 predicted 291
5 SASI_Hs02_00332622 predicted 360
6 SASI_Hs02_00332623 predicted 495
7 SASI_Hs02_00332624 predicted 290
8 SASI_Hs02_00332625 predicted 385
9 SASI_Hs01_00090953 predicted 324
10 SASI_Hs02_00332626 predicted 432
11 SASI_Hs01_00090954 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00408885 predicted 534
2 SASI_Rn02_00408886 predicted 539
3 SASI_Rn02_00408887 predicted 521
4 SASI_Rn02_00408888 predicted 699
5 SASI_Rn02_00408889 predicted 219
6 SASI_Rn02_00408890 predicted 458
7 SASI_Rn02_00408891 predicted 717
8 SASI_Rn02_00408892 predicted 233
9 SASI_Rn02_00408893 predicted 328
10 SASI_Rn02_00408894 predicted 210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323755 predicted 376
2 SASI_Mm02_00323756 predicted 186
3 SASI_Mm02_00323757 predicted 601
4 SASI_Mm01_00037163 predicted 258
5 SASI_Mm01_00037164 predicted 229
6 SASI_Mm01_00037165 predicted 399
7 SASI_Mm01_00037166 predicted 371
8 SASI_Mm01_00037167 predicted 418
9 SASI_Mm01_00037168 predicted 396
10 SASI_Mm01_00037169 predicted 433
11 SASI_Mm01_00037170 predicted 365
12 SASI_Mm01_00037171 predicted 210
13 SASI_Mm01_00037172 predicted 223
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001826
VALIDATED
CKS1B MISSION shRNA Bacterial Glycerol Stock
CDC28 protein kinase regulatory subunit 1B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001826.1-82s1c1
Sequence:CCGGCCCAAGGACATAGCCAAGCTGCTCGAGCAGCTTGGCTATGTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001826.1-67s1c1
Sequence:CCGGCGACATGTCATGCTGCCCAAGCTCGAGCTTGGGCAGCATGACATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001826.1-175s1c1
Sequence:CCGGCATTATATGATCCATGAACCACTCGAGTGGTTCATGGATCATATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001826.1-51s1c1
Sequence:CCGGCGAGGAGTTTGAGTATCGACACTCGAGTGTCGATACTCAAACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001826.1-222s1c1
Sequence:CCGGCCCACTACCCAAGAAACCAAACTCGAGTTTGGTTTCTTGGGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001826.1-115s1c1
Sequence:CCGGCATCTGATGTCTGAATCTGAACTCGAGTTCAGATTCAGACATCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001826.1-172s1c1
Sequence:CCGGGTCCATTATATGATCCATGAACTCGAGTTCATGGATCATATAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-210s21c1
Sequence:CCGGCATCTGATGTCTGAATCTGAACTCGAGTTCAGATTCAGACATCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-228s21c1
Sequence:CCGGGAATGGAGGAATCTTGGCGTTCTCGAGAACGCCAAGATTCCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-177s21c1
Sequence:CCGGCCCAAGGACATAGCCAAGCTGCTCGAGCAGCTTGGCTATGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-146s21c1
Sequence:CCGGCGAGGAGTTTGAGTATCGACACTCGAGTGTCGATACTCAAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001826
VALIDATED
CKS1B MISSION shRNA shRNA Plasmid DNA
CDC28 protein kinase regulatory subunit 1B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001826.1-82s1c1
Sequence:CCGGCCCAAGGACATAGCCAAGCTGCTCGAGCAGCTTGGCTATGTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001826.1-67s1c1
Sequence:CCGGCGACATGTCATGCTGCCCAAGCTCGAGCTTGGGCAGCATGACATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001826.1-175s1c1
Sequence:CCGGCATTATATGATCCATGAACCACTCGAGTGGTTCATGGATCATATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001826.1-51s1c1
Sequence:CCGGCGAGGAGTTTGAGTATCGACACTCGAGTGTCGATACTCAAACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001826.1-222s1c1
Sequence:CCGGCCCACTACCCAAGAAACCAAACTCGAGTTTGGTTTCTTGGGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001826.1-115s1c1
Sequence:CCGGCATCTGATGTCTGAATCTGAACTCGAGTTCAGATTCAGACATCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001826.1-172s1c1
Sequence:CCGGGTCCATTATATGATCCATGAACTCGAGTTCATGGATCATATAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-210s21c1
Sequence:CCGGCATCTGATGTCTGAATCTGAACTCGAGTTCAGATTCAGACATCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-228s21c1
Sequence:CCGGGAATGGAGGAATCTTGGCGTTCTCGAGAACGCCAAGATTCCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-177s21c1
Sequence:CCGGCCCAAGGACATAGCCAAGCTGCTCGAGCAGCTTGGCTATGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-146s21c1
Sequence:CCGGCGAGGAGTTTGAGTATCGACACTCGAGTGTCGATACTCAAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001826
VALIDATED
CKS1B MISSION shRNA Lentiviral Transduction Particles
CDC28 protein kinase regulatory subunit 1B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001826.1-82s1c1
Sequence:CCGGCCCAAGGACATAGCCAAGCTGCTCGAGCAGCTTGGCTATGTCCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001826.1-67s1c1
Sequence:CCGGCGACATGTCATGCTGCCCAAGCTCGAGCTTGGGCAGCATGACATGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001826.1-175s1c1
Sequence:CCGGCATTATATGATCCATGAACCACTCGAGTGGTTCATGGATCATATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195595    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001826.1-51s1c1
Sequence:CCGGCGAGGAGTTTGAGTATCGACACTCGAGTGTCGATACTCAAACTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037921    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001826.1-222s1c1
Sequence:CCGGCCCACTACCCAAGAAACCAAACTCGAGTTTGGTTTCTTGGGTAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037922    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_001826.1-115s1c1
Sequence:CCGGCATCTGATGTCTGAATCTGAACTCGAGTTCAGATTCAGACATCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_001826.1-172s1c1
Sequence:CCGGGTCCATTATATGATCCATGAACTCGAGTTCATGGATCATATAATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-210s21c1
Sequence:CCGGCATCTGATGTCTGAATCTGAACTCGAGTTCAGATTCAGACATCAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333018    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-228s21c1
Sequence:CCGGGAATGGAGGAATCTTGGCGTTCTCGAGAACGCCAAGATTCCTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-177s21c1
Sequence:CCGGCCCAAGGACATAGCCAAGCTGCTCGAGCAGCTTGGCTATGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001826.2-146s21c1
Sequence:CCGGCGAGGAGTTTGAGTATCGACACTCGAGTGTCGATACTCAAACTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016904
VALIDATED
CKS1B MISSION shRNA Bacterial Glycerol Stock
CDC28 protein kinase regulatory subunit 1B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016904.1-126s1c1
Sequence:CCGGGTTCGAATACCGGCATGTCATCTCGAGATGACATGCCGGTATTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016904.1-108s1c1
Sequence:CCGGCAAATACGACGACGAGGAGTTCTCGAGAACTCCTCGTCGTCGTATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016904.1-192s1c1
Sequence:CCGGGTCTGAATCTGAATGGAGGAACTCGAGTTCCTCCATTCAGATTCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-160s21c1
Sequence:CCGGATAGCCAAGCTGGTCCCGAAACTCGAGTTTCGGGACCAGCTTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-268s21c1
Sequence:CCGGCCTCACATCTTACTGTTCCGACTCGAGTCGGAACAGTAAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-126s21c1
Sequence:CCGGGTTCGAATACCGGCATGTCATCTCGAGATGACATGCCGGTATTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-192s21c1
Sequence:CCGGGTCTGAATCTGAATGGAGGAACTCGAGTTCCTCCATTCAGATTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-541s21c1
Sequence:CCGGAGCAGGCCATATTAGTCATTTCTCGAGAAATGACTAATATGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016904
VALIDATED
CKS1B MISSION shRNA shRNA Plasmid DNA
CDC28 protein kinase regulatory subunit 1B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016904.1-126s1c1
Sequence:CCGGGTTCGAATACCGGCATGTCATCTCGAGATGACATGCCGGTATTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016904.1-108s1c1
Sequence:CCGGCAAATACGACGACGAGGAGTTCTCGAGAACTCCTCGTCGTCGTATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016904.1-192s1c1
Sequence:CCGGGTCTGAATCTGAATGGAGGAACTCGAGTTCCTCCATTCAGATTCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-160s21c1
Sequence:CCGGATAGCCAAGCTGGTCCCGAAACTCGAGTTTCGGGACCAGCTTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-268s21c1
Sequence:CCGGCCTCACATCTTACTGTTCCGACTCGAGTCGGAACAGTAAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-126s21c1
Sequence:CCGGGTTCGAATACCGGCATGTCATCTCGAGATGACATGCCGGTATTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-192s21c1
Sequence:CCGGGTCTGAATCTGAATGGAGGAACTCGAGTTCCTCCATTCAGATTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-541s21c1
Sequence:CCGGAGCAGGCCATATTAGTCATTTCTCGAGAAATGACTAATATGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016904
VALIDATED
CKS1B MISSION shRNA Lentiviral Transduction Particles
CDC28 protein kinase regulatory subunit 1B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016904.1-126s1c1
Sequence:CCGGGTTCGAATACCGGCATGTCATCTCGAGATGACATGCCGGTATTCGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025043    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016904.1-108s1c1
Sequence:CCGGCAAATACGACGACGAGGAGTTCTCGAGAACTCCTCGTCGTCGTATTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025042    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016904.1-192s1c1
Sequence:CCGGGTCTGAATCTGAATGGAGGAACTCGAGTTCCTCCATTCAGATTCAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-160s21c1
Sequence:CCGGATAGCCAAGCTGGTCCCGAAACTCGAGTTTCGGGACCAGCTTGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274691    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-268s21c1
Sequence:CCGGCCTCACATCTTACTGTTCCGACTCGAGTCGGAACAGTAAGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274693    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-126s21c1
Sequence:CCGGGTTCGAATACCGGCATGTCATCTCGAGATGACATGCCGGTATTCGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274751    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-192s21c1
Sequence:CCGGGTCTGAATCTGAATGGAGGAACTCGAGTTCCTCCATTCAGATTCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274752    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016904.1-541s21c1
Sequence:CCGGAGCAGGCCATATTAGTCATTTCTCGAGAAATGACTAATATGGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks