EMAIL THIS PAGE TO A FRIEND

CKS2

CDC28 protein kinase regulatory subunit 2

93 Gene Product Result for
Synonyms: CKSHS2
UniProtKB ID: P33552, Q6FGI9
Gene ID:
Human(1164) Summary: CKS2 protein binds to the catalytic subunit of the cyclin dependent kinases and is essential for their biological function. The CKS2 mRNA is found to be expressed in different patterns through the cell cycle in HeLa cells, which reflects specialized role for the encoded protein. [provided by RefSeq, Jul 2008]
Mouse(66197) CDC28 protein kinase regulatory subunit 2
Rat(498709) CDC28 protein kinase regulatory subunit 2
domestic guinea pig(100730961) CDC28 protein kinase regulatory subunit 2
naked mole-rat(101714991) CDC28 protein kinase regulatory subunit 2
sheep(101103869) CDC28 protein kinase regulatory subunit 2
Zebrafish(561930) CDC28 protein kinase regulatory subunit 2
cow(767985) CDC28 protein kinase regulatory subunit 2
domestic cat(101086011) CDC28 protein kinase regulatory subunit 2
chicken(768830) CDC28 protein kinase regulatory subunit 2
Thale Cress(817341) cyclin-dependent kinases regulatory subunit 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025415 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025415 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025415 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001827 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001827 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001827 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001827 siRNAs that have been validated in the lab human pricing
NM_001126083 Rosetta Predictions rat pricing
NM_025415 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001827 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_WI_00000029 validated 393
1 SASI_WI_00000028 validated 499
1 SASI_WI_00000030 validated 528
2 SASI_Hs02_00332627 predicted 250
3 SASI_Hs01_00235717 predicted 372
4 SASI_Hs01_00235718 predicted 278
5 SASI_Hs01_00235719 predicted 285
6 SASI_Hs02_00332628 predicted 253
7 SASI_Hs01_00235720 predicted 246
8 SASI_Hs01_00235721 predicted 384
9 SASI_Hs01_00235722 predicted 218
10 SASI_Hs01_00235724 predicted 217
11 SASI_Hs02_00332629 predicted 279
12 SASI_Hs01_00235723 predicted 383
13 SASI_Hs01_00235725 predicted 243
14 SASI_Hs01_00235726 predicted 247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126083 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00252843 predicted 387
2 SASI_Rn02_00252844 predicted 370
3 SASI_Rn02_00252845 predicted 252
4 SASI_Rn02_00252846 predicted 259
5 SASI_Rn02_00252847 predicted 211
6 SASI_Rn02_00252848 predicted 293
7 SASI_Rn02_00252849 predicted 277
8 SASI_Rn02_00252850 predicted 291
9 SASI_Rn02_00252851 predicted 286
10 SASI_Rn02_00252852 predicted 387
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025415 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328189 predicted 427
2 SASI_Mm01_00140359 predicted 364
3 SASI_Mm01_00140360 predicted 369
4 SASI_Mm02_00328190 predicted 209
5 SASI_Mm02_00328191 predicted 306
6 SASI_Mm02_00328192 predicted 255
7 SASI_Mm01_00140363 predicted 308
8 SASI_Mm02_00328193 predicted 202
9 SASI_Mm02_00328194 predicted 195
10 SASI_Mm02_00328195 predicted 369
11 SASI_Mm01_00140357 predicted 243
12 SASI_Mm01_00140358 predicted 277
13 SASI_Mm01_00140361 predicted 243
14 SASI_Mm01_00140362 predicted 248
15 SASI_Mm01_00140364 predicted 220
16 SASI_Mm01_00140365 predicted 235
17 SASI_Mm01_00140366 predicted 245
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025415
CKS2 MISSION shRNA Bacterial Glycerol Stock
CDC28 protein kinase regulatory subunit 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025415.3-359s21c1
Sequence:CCGGCATGAGCCAGAACCGCATATTCTCGAGAATATGCGGTTCTGGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025415.3-522s21c1
Sequence:CCGGTACCTGTGCATGCGCTGTATTCTCGAGAATACAGCGCATGCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025415.3-473s21c1
Sequence:CCGGTAAGGTAGTATTCAGTGAATACTCGAGTATTCACTGAATACTACCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025415.3-251s21c1
Sequence:CCGGTTACCCAGAGAACTCTCTAAACTCGAGTTTAGAGAGTTCTCTGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-162s1c1
Sequence:CCGGCCCAGAGAACTCTCTAAACAACTCGAGTTGTTTAGAGAGTTCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-288s1c1
Sequence:CCGGCTTCTCTTTAGACGACCTCTTCTCGAGAAGAGGTCGTCTAAAGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-276s1c1
Sequence:CCGGGAACCGCATATTCTTCTCTTTCTCGAGAAAGAGAAGAATATGCGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-171s1c1
Sequence:CCGGCTCTCTAAACAAGTACCCAAACTCGAGTTTGGGTACTTGTTTAGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-150s1c1
Sequence:CCGGCATGTCATGTTACCCAGAGAACTCGAGTTCTCTGGGTAACATGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025415
CKS2 MISSION shRNA shRNA Plasmid DNA
CDC28 protein kinase regulatory subunit 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025415.3-359s21c1
Sequence:CCGGCATGAGCCAGAACCGCATATTCTCGAGAATATGCGGTTCTGGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025415.3-522s21c1
Sequence:CCGGTACCTGTGCATGCGCTGTATTCTCGAGAATACAGCGCATGCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025415.3-473s21c1
Sequence:CCGGTAAGGTAGTATTCAGTGAATACTCGAGTATTCACTGAATACTACCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025415.3-251s21c1
Sequence:CCGGTTACCCAGAGAACTCTCTAAACTCGAGTTTAGAGAGTTCTCTGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-162s1c1
Sequence:CCGGCCCAGAGAACTCTCTAAACAACTCGAGTTGTTTAGAGAGTTCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-288s1c1
Sequence:CCGGCTTCTCTTTAGACGACCTCTTCTCGAGAAGAGGTCGTCTAAAGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-276s1c1
Sequence:CCGGGAACCGCATATTCTTCTCTTTCTCGAGAAAGAGAAGAATATGCGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-171s1c1
Sequence:CCGGCTCTCTAAACAAGTACCCAAACTCGAGTTTGGGTACTTGTTTAGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-150s1c1
Sequence:CCGGCATGTCATGTTACCCAGAGAACTCGAGTTCTCTGGGTAACATGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025415
CKS2 MISSION shRNA Lentiviral Transduction Particles
CDC28 protein kinase regulatory subunit 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025415.3-359s21c1
Sequence:CCGGCATGAGCCAGAACCGCATATTCTCGAGAATATGCGGTTCTGGCTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025415.3-522s21c1
Sequence:CCGGTACCTGTGCATGCGCTGTATTCTCGAGAATACAGCGCATGCACAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025415.3-473s21c1
Sequence:CCGGTAAGGTAGTATTCAGTGAATACTCGAGTATTCACTGAATACTACCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025415.3-251s21c1
Sequence:CCGGTTACCCAGAGAACTCTCTAAACTCGAGTTTAGAGAGTTCTCTGGGTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-162s1c1
Sequence:CCGGCCCAGAGAACTCTCTAAACAACTCGAGTTGTTTAGAGAGTTCTCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025048    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-288s1c1
Sequence:CCGGCTTCTCTTTAGACGACCTCTTCTCGAGAAGAGGTCGTCTAAAGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-276s1c1
Sequence:CCGGGAACCGCATATTCTTCTCTTTCTCGAGAAAGAGAAGAATATGCGGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-171s1c1
Sequence:CCGGCTCTCTAAACAAGTACCCAAACTCGAGTTTGGGTACTTGTTTAGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025415.1-150s1c1
Sequence:CCGGCATGTCATGTTACCCAGAGAACTCGAGTTCTCTGGGTAACATGACATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001827
VALIDATED
CKS2 MISSION shRNA Bacterial Glycerol Stock
CDC28 protein kinase regulatory subunit 2
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001827.1-285s21c1
Sequence:CCGGCCACATATTCTTCTCTTTAGACTCGAGTCTAAAGAGAAGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001827.1-131s21c1
Sequence:CCGGCTTCGACGAACACTACGAGTACTCGAGTACTCGTAGTGTTCGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001827.1-231s21c1
Sequence:CCGGCTTGGTGTCCAACAGAGTCTACTCGAGTAGACTCTGTTGGACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001827.1-231s1c1
Sequence:CCGGCTTGGTGTCCAACAGAGTCTACTCGAGTAGACTCTGTTGGACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001827.1-255s1c1
Sequence:CCGGTGGGTTCATTACATGATTCATCTCGAGATGAATCATGTAATGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001827.1-153s1c1
Sequence:CCGGCGGCATGTTATGTTACCCAGACTCGAGTCTGGGTAACATAACATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-285s1c1
Sequence:CCGGCCACATATTCTTCTCTTTAGACTCGAGTCTAAAGAGAAGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-131s1c1
Sequence:CCGGCTTCGACGAACACTACGAGTACTCGAGTACTCGTAGTGTTCGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-245s1c1
Sequence:CCGGGAGTCTAGGCTGGGTTCATTACTCGAGTAATGAACCCAGCCTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001827.1-134s1c1
Sequence:CCGGCGACGAACACTACGAGTACCGCTCGAGCGGTACTCGTAGTGTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-125s1c1
Sequence:CCGGCAAGTACTTCGACGAACACTACTCGAGTAGTGTTCGTCGAAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-123s1c1
Sequence:CCGGGACAAGTACTTCGACGAACACCTCGAGGTGTTCGTCGAAGTACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-440s1c1
Sequence:CCGGCTGTGCATGAGCTGTATTCTTCTCGAGAAGAATACAGCTCATGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001827
VALIDATED
CKS2 MISSION shRNA shRNA Plasmid DNA
CDC28 protein kinase regulatory subunit 2
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001827.1-285s21c1
Sequence:CCGGCCACATATTCTTCTCTTTAGACTCGAGTCTAAAGAGAAGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001827.1-131s21c1
Sequence:CCGGCTTCGACGAACACTACGAGTACTCGAGTACTCGTAGTGTTCGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001827.1-231s21c1
Sequence:CCGGCTTGGTGTCCAACAGAGTCTACTCGAGTAGACTCTGTTGGACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001827.1-231s1c1
Sequence:CCGGCTTGGTGTCCAACAGAGTCTACTCGAGTAGACTCTGTTGGACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001827.1-255s1c1
Sequence:CCGGTGGGTTCATTACATGATTCATCTCGAGATGAATCATGTAATGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001827.1-153s1c1
Sequence:CCGGCGGCATGTTATGTTACCCAGACTCGAGTCTGGGTAACATAACATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-285s1c1
Sequence:CCGGCCACATATTCTTCTCTTTAGACTCGAGTCTAAAGAGAAGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-131s1c1
Sequence:CCGGCTTCGACGAACACTACGAGTACTCGAGTACTCGTAGTGTTCGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-245s1c1
Sequence:CCGGGAGTCTAGGCTGGGTTCATTACTCGAGTAATGAACCCAGCCTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001827.1-134s1c1
Sequence:CCGGCGACGAACACTACGAGTACCGCTCGAGCGGTACTCGTAGTGTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-125s1c1
Sequence:CCGGCAAGTACTTCGACGAACACTACTCGAGTAGTGTTCGTCGAAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-123s1c1
Sequence:CCGGGACAAGTACTTCGACGAACACCTCGAGGTGTTCGTCGAAGTACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-440s1c1
Sequence:CCGGCTGTGCATGAGCTGTATTCTTCTCGAGAAGAATACAGCTCATGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001827
VALIDATED
CKS2 MISSION shRNA Lentiviral Transduction Particles
CDC28 protein kinase regulatory subunit 2
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001827.1-285s21c1
Sequence:CCGGCCACATATTCTTCTCTTTAGACTCGAGTCTAAAGAGAAGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001827.1-131s21c1
Sequence:CCGGCTTCGACGAACACTACGAGTACTCGAGTACTCGTAGTGTTCGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001827.1-231s21c1
Sequence:CCGGCTTGGTGTCCAACAGAGTCTACTCGAGTAGACTCTGTTGGACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037545    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001827.1-231s1c1
Sequence:CCGGCTTGGTGTCCAACAGAGTCTACTCGAGTAGACTCTGTTGGACACCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_001827.1-255s1c1
Sequence:CCGGTGGGTTCATTACATGATTCATCTCGAGATGAATCATGTAATGAACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001827.1-153s1c1
Sequence:CCGGCGGCATGTTATGTTACCCAGACTCGAGTCTGGGTAACATAACATGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-285s1c1
Sequence:CCGGCCACATATTCTTCTCTTTAGACTCGAGTCTAAAGAGAAGAATATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-131s1c1
Sequence:CCGGCTTCGACGAACACTACGAGTACTCGAGTACTCGTAGTGTTCGTCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-245s1c1
Sequence:CCGGGAGTCTAGGCTGGGTTCATTACTCGAGTAATGAACCCAGCCTAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001827.1-134s1c1
Sequence:CCGGCGACGAACACTACGAGTACCGCTCGAGCGGTACTCGTAGTGTTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-125s1c1
Sequence:CCGGCAAGTACTTCGACGAACACTACTCGAGTAGTGTTCGTCGAAGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199591    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-123s1c1
Sequence:CCGGGACAAGTACTTCGACGAACACCTCGAGGTGTTCGTCGAAGTACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195708    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_001827.1-440s1c1
Sequence:CCGGCTGTGCATGAGCTGTATTCTTCTCGAGAAGAATACAGCTCATGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks