EMAIL THIS PAGE TO A FRIEND

CLASP1

cytoplasmic linker associated protein 1

237 Gene Product Result for
Synonyms: MAST1
UniProtKB ID: Q7Z460, O75118, Q2KHQ9, Q5H9P0, Q8N5B8, Q9BQT5
Gene ID:
Human(23332) Summary: CLASPs, such as CLASP1, are nonmotor microtubule-associated proteins that interact with CLIPs (e.g., CLIP170; MIM 179838). CLASP1 is involved in the regulation of microtubule dynamics at the kinetochore and throughout the spindle (Maiato et al., 2003 [PubMed 12837247]
Mouse(76707) CLIP associating protein 1
Rat(304740) cytoplasmic linker associated protein 1
chicken(429042) cytoplasmic linker associated protein 1
dog(100684635) cytoplasmic linker associated protein 1
domestic cat(101099821) cytoplasmic linker associated protein 1
cow(523441) cytoplasmic linker associated protein 1
Horse(100068913) cytoplasmic linker associated protein 1
sheep(101114679) cytoplasmic linker associated protein 1
Domestic Rabbit(100345130) cytoplasmic linker associated protein 1
naked mole-rat(101723506) cytoplasmic linker associated protein 1
domestic guinea pig(100715840) cytoplasmic linker associated protein 1
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081276 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081276 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081276 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015282 Rosetta Predictions human pricing
XM_001053715 Rosetta Predictions rat pricing
XM_222568 Rosetta Predictions rat pricing
NM_001081276 Rosetta Predictions mouse pricing
NM_029709 Rosetta Predictions mouse pricing
NM_177548 Rosetta Predictions mouse pricing
XM_884205 Rosetta Predictions mouse pricing
XM_895382 Rosetta Predictions mouse pricing
XM_895411 Rosetta Predictions mouse pricing
XM_895420 Rosetta Predictions mouse pricing
XM_895430 Rosetta Predictions mouse pricing
XM_895458 Rosetta Predictions mouse pricing
XM_895476 Rosetta Predictions mouse pricing
XM_895505 Rosetta Predictions mouse pricing
XM_895516 Rosetta Predictions mouse pricing
XM_993065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00231872 predicted 4022
2 SASI_Hs02_00347454 predicted 2565
3 SASI_Hs01_00231873 predicted 3265
4 SASI_Hs02_00347455 predicted 3896
5 SASI_Hs01_00231874 predicted 4229
6 SASI_Hs01_00231875 predicted 540
7 SASI_Hs01_00231876 predicted 2129
8 SASI_Hs02_00347456 predicted 719
9 SASI_Hs01_00231877 predicted 1667
10 SASI_Hs01_00231879 predicted 2847
11 SASI_Hs01_00231878 predicted 2830
12 SASI_Hs01_00231880 predicted 973
13 SASI_Hs01_00231881 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001053715 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00273320 predicted 4104
2 SASI_Rn02_00273321 predicted 3887
3 SASI_Rn02_00273322 predicted 2200
4 SASI_Rn02_00273323 predicted 2091
5 SASI_Rn02_00273324 predicted 1967
6 SASI_Rn02_00273325 predicted 3439
7 SASI_Rn02_00273326 predicted 1077
8 SASI_Rn02_00273327 predicted 2937
9 SASI_Rn02_00273328 predicted 1247
10 SASI_Rn02_00273329 predicted 5098
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_222568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00156562 predicted 2377
2 SASI_Rn01_00156563 predicted 1546
3 SASI_Rn01_00156564 predicted 2699
4 SASI_Rn01_00156565 predicted 3841
5 SASI_Rn01_00156566 predicted 1967
6 SASI_Rn01_00156567 predicted 1848
7 SASI_Rn01_00156568 predicted 3283
8 SASI_Rn01_00156569 predicted 3935
9 SASI_Rn01_00156570 predicted 3636
10 SASI_Rn01_00156571 predicted 4898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081276 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296887 predicted 3727
2 SASI_Mm02_00296888 predicted 2318
3 SASI_Mm02_00296889 predicted 1244
4 SASI_Mm02_00296890 predicted 3738
5 SASI_Mm02_00296891 predicted 3647
6 SASI_Mm02_00296892 predicted 5266
7 SASI_Mm02_00296893 predicted 2083
8 SASI_Mm02_00296894 predicted 1969
9 SASI_Mm02_00296895 predicted 4616
10 SASI_Mm02_00296896 predicted 3838
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335775 predicted 3614
2 SASI_Mm02_00335776 predicted 2321
3 SASI_Mm02_00335777 predicted 1240
4 SASI_Mm02_00335778 predicted 3627
5 SASI_Mm02_00335779 predicted 3535
6 SASI_Mm02_00335780 predicted 5041
7 SASI_Mm02_00335781 predicted 2087
8 SASI_Mm02_00335782 predicted 1970
9 SASI_Mm02_00335783 predicted 4387
10 SASI_Mm02_00335784 predicted 3727
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177548 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347709 predicted 3631
2 SASI_Mm02_00347710 predicted 2317
3 SASI_Mm02_00347711 predicted 1242
4 SASI_Mm02_00347712 predicted 3657
5 SASI_Mm02_00347713 predicted 3565
6 SASI_Mm02_00347714 predicted 5059
7 SASI_Mm02_00347715 predicted 2082
8 SASI_Mm02_00347716 predicted 1973
9 SASI_Mm02_00347717 predicted 4416
10 SASI_Mm02_00347718 predicted 3748
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_884205 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207900 predicted 2501
2 SASI_Mm01_00207901 predicted 2320
3 SASI_Mm01_00207902 predicted 1245
4 SASI_Mm01_00207903 predicted 3747
5 SASI_Mm01_00207904 predicted 3651
6 SASI_Mm01_00207905 predicted 2085
7 SASI_Mm01_00207906 predicted 1970
8 SASI_Mm01_00207907 predicted 3841
9 SASI_Mm01_00207908 predicted 5226
10 SASI_Mm01_00207909 predicted 1194
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00235662 predicted 2498
2 SASI_Mm01_00235663 predicted 2321
3 SASI_Mm01_00235664 predicted 3859
4 SASI_Mm01_00235665 predicted 3765
5 SASI_Mm01_00235666 predicted 2089
6 SASI_Mm01_00235667 predicted 1974
7 SASI_Mm01_00235668 predicted 3957
8 SASI_Mm01_00235669 predicted 5221
9 SASI_Mm01_00235670 predicted 936
10 SASI_Mm01_00235671 predicted 2648
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895411 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00216285 predicted 1253
2 SASI_Mm01_00216286 predicted 2300
3 SASI_Mm01_00216287 predicted 1025
4 SASI_Mm01_00216288 predicted 2215
5 SASI_Mm01_00216289 predicted 2093
6 SASI_Mm01_00216290 predicted 1728
7 SASI_Mm01_00216291 predicted 1979
8 SASI_Mm01_00216292 predicted 1659
9 SASI_Mm01_00216293 predicted 2032
10 SASI_Mm01_00216294 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00254534 predicted 2246
2 SASI_Mm01_00254535 predicted 2916
3 SASI_Mm01_00254536 predicted 2204
4 SASI_Mm01_00254537 predicted 2494
5 SASI_Mm01_00254538 predicted 2325
6 SASI_Mm01_00254539 predicted 1250
7 SASI_Mm01_00254540 predicted 3072
8 SASI_Mm01_00254541 predicted 2972
9 SASI_Mm01_00254542 predicted 1016
10 SASI_Mm01_00254543 predicted 2093
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895430 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00233305 predicted 1247
2 SASI_Mm01_00233306 predicted 1018
3 SASI_Mm01_00233307 predicted 1732
4 SASI_Mm01_00233308 predicted 1445
5 SASI_Mm01_00233309 predicted 1200
6 SASI_Mm01_00233310 predicted 929
7 SASI_Mm01_00233311 predicted 1313
8 SASI_Mm01_00233312 predicted 1876
9 SASI_Mm01_00233313 predicted 1535
10 SASI_Mm01_00233314 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895458 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230923 predicted 2498
2 SASI_Mm01_00230924 predicted 2322
3 SASI_Mm01_00230925 predicted 4193
4 SASI_Mm01_00230926 predicted 1248
5 SASI_Mm01_00230927 predicted 3723
6 SASI_Mm01_00230928 predicted 3634
7 SASI_Mm01_00230929 predicted 2085
8 SASI_Mm01_00230930 predicted 1973
9 SASI_Mm01_00230931 predicted 5187
10 SASI_Mm01_00230932 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895476 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00208536 predicted 2493
2 SASI_Mm01_00208537 predicted 2325
3 SASI_Mm01_00208538 predicted 1254
4 SASI_Mm01_00208539 predicted 3727
5 SASI_Mm01_00208540 predicted 3635
6 SASI_Mm01_00208541 predicted 2094
7 SASI_Mm01_00208542 predicted 1970
8 SASI_Mm01_00208543 predicted 3817
9 SASI_Mm01_00208544 predicted 5196
10 SASI_Mm01_00208545 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00256204 predicted 2497
2 SASI_Mm01_00256205 predicted 2325
3 SASI_Mm01_00256206 predicted 1251
4 SASI_Mm01_00256207 predicted 3659
5 SASI_Mm01_00256208 predicted 3570
6 SASI_Mm01_00256209 predicted 2093
7 SASI_Mm01_00256210 predicted 2639
8 SASI_Mm01_00256211 predicted 1973
9 SASI_Mm01_00256212 predicted 3756
10 SASI_Mm01_00256213 predicted 5023
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_895516 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00219195 predicted 2491
2 SASI_Mm01_00219196 predicted 2322
3 SASI_Mm01_00219197 predicted 3976
4 SASI_Mm01_00219198 predicted 1254
5 SASI_Mm01_00219199 predicted 3609
6 SASI_Mm01_00219200 predicted 3521
7 SASI_Mm01_00219201 predicted 2092
8 SASI_Mm01_00219202 predicted 1974
9 SASI_Mm01_00219203 predicted 3706
10 SASI_Mm01_00219204 predicted 4975
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_993065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00246763 predicted 1760
2 SASI_Mm01_00246764 predicted 1588
3 SASI_Mm01_00246765 predicted 523
4 SASI_Mm01_00246766 predicted 3122
5 SASI_Mm01_00246767 predicted 3035
6 SASI_Mm01_00246768 predicted 1364
7 SASI_Mm01_00246769 predicted 1239
8 SASI_Mm01_00246770 predicted 3225
9 SASI_Mm01_00246771 predicted 4486
10 SASI_Mm01_00246772 predicted 1907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015282
CLASP1 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic linker associated protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015282.1-7701s1c1
Sequence:CCGGCCCTTTATTTATCAAGCGTAACTCGAGTTACGCTTGATAAATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-1716s1c1
Sequence:CCGGCCCTAGGTTAATACCTGTCATCTCGAGATGACAGGTATTAACCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-670s1c1
Sequence:CCGGCCAAGTCTAATAGACAGACTACTCGAGTAGTCTGTCTATTAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-3556s1c1
Sequence:CCGGCCTGAATTTACCATGTTACTTCTCGAGAAGTAACATGGTAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-1407s1c1
Sequence:CCGGGCAGAGAGTAAATGCTCTAAACTCGAGTTTAGAGCATTTACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015282.2-2890s21c1
Sequence:CCGGGTTTGCTCTGAGCGCTCATATCTCGAGATATGAGCGCTCAGAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015282.2-3985s21c1
Sequence:CCGGGATCTGAATGAGCCAATTAAACTCGAGTTTAATTGGCTCATTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015282
CLASP1 MISSION shRNA shRNA Plasmid DNA
cytoplasmic linker associated protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015282.1-7701s1c1
Sequence:CCGGCCCTTTATTTATCAAGCGTAACTCGAGTTACGCTTGATAAATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-1716s1c1
Sequence:CCGGCCCTAGGTTAATACCTGTCATCTCGAGATGACAGGTATTAACCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-670s1c1
Sequence:CCGGCCAAGTCTAATAGACAGACTACTCGAGTAGTCTGTCTATTAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-3556s1c1
Sequence:CCGGCCTGAATTTACCATGTTACTTCTCGAGAAGTAACATGGTAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-1407s1c1
Sequence:CCGGGCAGAGAGTAAATGCTCTAAACTCGAGTTTAGAGCATTTACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015282.2-2890s21c1
Sequence:CCGGGTTTGCTCTGAGCGCTCATATCTCGAGATATGAGCGCTCAGAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015282.2-3985s21c1
Sequence:CCGGGATCTGAATGAGCCAATTAAACTCGAGTTTAATTGGCTCATTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015282
CLASP1 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic linker associated protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113931    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_015282.1-7701s1c1
Sequence:CCGGCCCTTTATTTATCAAGCGTAACTCGAGTTACGCTTGATAAATAAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113934    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-1716s1c1
Sequence:CCGGCCCTAGGTTAATACCTGTCATCTCGAGATGACAGGTATTAACCTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-670s1c1
Sequence:CCGGCCAAGTCTAATAGACAGACTACTCGAGTAGTCTGTCTATTAGACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-3556s1c1
Sequence:CCGGCCTGAATTTACCATGTTACTTCTCGAGAAGTAACATGGTAAATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015282.1-1407s1c1
Sequence:CCGGGCAGAGAGTAAATGCTCTAAACTCGAGTTTAGAGCATTTACTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015282.2-2890s21c1
Sequence:CCGGGTTTGCTCTGAGCGCTCATATCTCGAGATATGAGCGCTCAGAGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015282.2-3985s21c1
Sequence:CCGGGATCTGAATGAGCCAATTAAACTCGAGTTTAATTGGCTCATTCAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081276
VALIDATED
CLASP1 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic linker associated protein 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000253373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-5994s21c1
Sequence:CCGGAGATTGGAACCAGACTTATATCTCGAGATATAAGTCTGGTTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-4324s21c1
Sequence:CCGGCCGAAGCCAGGAGGATCTAAACTCGAGTTTAGATCCTCCTGGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-1974s21c1
Sequence:CCGGCCATTATGCCAACTATCTTTACTCGAGTAAAGATAGTTGGCATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-919s21c1
Sequence:CCGGTTGGGTGAACTCTAGCAATTACTCGAGTAATTGCTAGAGTTCACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081276
VALIDATED
CLASP1 MISSION shRNA shRNA Plasmid DNA
cytoplasmic linker associated protein 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000253373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-5994s21c1
Sequence:CCGGAGATTGGAACCAGACTTATATCTCGAGATATAAGTCTGGTTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-4324s21c1
Sequence:CCGGCCGAAGCCAGGAGGATCTAAACTCGAGTTTAGATCCTCCTGGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-1974s21c1
Sequence:CCGGCCATTATGCCAACTATCTTTACTCGAGTAAAGATAGTTGGCATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-919s21c1
Sequence:CCGGTTGGGTGAACTCTAGCAATTACTCGAGTAATTGCTAGAGTTCACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081276
VALIDATED
CLASP1 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic linker associated protein 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000253373    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-5994s21c1
Sequence:CCGGAGATTGGAACCAGACTTATATCTCGAGATATAAGTCTGGTTCCAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-4324s21c1
Sequence:CCGGCCGAAGCCAGGAGGATCTAAACTCGAGTTTAGATCCTCCTGGCTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-1974s21c1
Sequence:CCGGCCATTATGCCAACTATCTTTACTCGAGTAAAGATAGTTGGCATAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_001081276.1-919s21c1
Sequence:CCGGTTGGGTGAACTCTAGCAATTACTCGAGTAATTGCTAGAGTTCACCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks