EMAIL THIS PAGE TO A FRIEND

CLASP2

cytoplasmic linker associated protein 2

188 Gene Product Result for
Gene ID:
Mouse(76499) CLIP associating protein 2
Rat(114514) cytoplasmic linker associated protein 2
Zebrafish(404604) cytoplasmic linker associated protein 2
cow(531418) cytoplasmic linker associated protein 2
Horse(100055883) cytoplasmic linker associated protein 2
domestic cat(101097755) cytoplasmic linker associated protein 2
dog(477012) cytoplasmic linker associated protein 2
chicken(420724) cytoplasmic linker associated protein 2
domestic guinea pig(100720721) cytoplasmic linker associated protein 2
naked mole-rat(101718384) cytoplasmic linker associated protein 2
sheep(101106631) cytoplasmic linker associated protein 2
Gene Class: Cytoskeleton
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015097 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015097 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015097 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015097 Rosetta Predictions human pricing
NM_053722 Rosetta Predictions rat pricing
NM_001081960 Rosetta Predictions mouse pricing
NM_001114347 Rosetta Predictions mouse pricing
NM_029633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015097 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146296 predicted 4728
2 SASI_Hs01_00146297 predicted 920
3 SASI_Hs02_00346981 predicted 834
4 SASI_Hs01_00146298 predicted 587
5 SASI_Hs01_00146299 predicted 3600
6 SASI_Hs02_00346982 predicted 3967
7 SASI_Hs01_00146303 predicted 2894
8 SASI_Hs01_00146304 predicted 4647
9 SASI_Hs01_00146305 predicted 1469
10 SASI_Hs02_00346983 predicted 698
11 SASI_Hs01_00146300 predicted 1511
12 SASI_Hs01_00146301 predicted 4604
13 SASI_Hs01_00146302 predicted 2823
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053722 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266487 predicted 2686
2 SASI_Rn01_00089322 predicted 3856
3 SASI_Rn01_00089323 predicted 2133
4 SASI_Rn02_00266488 predicted 3692
5 SASI_Rn01_00089324 predicted 362
6 SASI_Rn01_00089325 predicted 887
7 SASI_Rn01_00089326 predicted 3131
8 SASI_Rn01_00089327 predicted 353
9 SASI_Rn01_00089328 predicted 1559
10 SASI_Rn01_00089329 predicted 1735
11 SASI_Rn01_00089330 predicted 2012
12 SASI_Rn01_00089331 predicted 3279
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00299102 predicted 3864
2 SASI_Mm02_00299103 predicted 3730
3 SASI_Mm02_00299104 predicted 3774
4 SASI_Mm02_00299105 predicted 3901
5 SASI_Mm02_00299106 predicted 421
6 SASI_Mm02_00299107 predicted 790
7 SASI_Mm02_00299108 predicted 2491
8 SASI_Mm02_00299109 predicted 3169
9 SASI_Mm02_00299110 predicted 1436
10 SASI_Mm02_00299111 predicted 936
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308570 predicted 4608
2 SASI_Mm02_00308571 predicted 4474
3 SASI_Mm02_00308572 predicted 4519
4 SASI_Mm02_00308573 predicted 4645
5 SASI_Mm02_00308574 predicted 1158
6 SASI_Mm02_00308575 predicted 1530
7 SASI_Mm02_00308576 predicted 3239
8 SASI_Mm02_00308577 predicted 3917
9 SASI_Mm02_00308578 predicted 2185
10 SASI_Mm02_00308579 predicted 1674
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094783 predicted 3864
2 SASI_Mm01_00094784 predicted 3728
3 SASI_Mm01_00094785 predicted 3773
4 SASI_Mm01_00094786 predicted 3897
5 SASI_Mm01_00094788 predicted 422
6 SASI_Mm01_00094789 predicted 790
7 SASI_Mm02_00335628 predicted 2490
8 SASI_Mm01_00094790 predicted 3167
9 SASI_Mm01_00094791 predicted 1436
10 SASI_Mm01_00094792 predicted 937
11 SASI_Mm01_00094787 predicted 819
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029633
VALIDATED
CLASP2 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic linker associated protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-2734s21c1
Sequence:CCGGGCTACTAAACTTCTTCACAATCTCGAGATTGTGAAGAAGTTTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-635s21c1
Sequence:CCGGGCATCACTGTTGCTCACCTTTCTCGAGAAAGGTGAGCAACAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-424s21c1
Sequence:CCGGGAACTTGAAGAGACGTTAAATCTCGAGATTTAACGTCTCTTCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-535s21c1
Sequence:CCGGGCCGCACAGTATGATTGCTTTCTCGAGAAAGCAATCATACTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-2021s1c1
Sequence:CCGGCGTGTTCAGAACGCTCCTATACTCGAGTATAGGAGCGTTCTGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-535s1c1
Sequence:CCGGGCCGCACAGTATGATTGCTTTCTCGAGAAAGCAATCATACTGTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-635s1c1
Sequence:CCGGGCATCACTGTTGCTCACCTTTCTCGAGAAAGGTGAGCAACAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029633.1-424s1c1
Sequence:CCGGGAACTTGAAGAGACGTTAAATCTCGAGATTTAACGTCTCTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-2734s1c1
Sequence:CCGGGCTACTAAACTTCTTCACAATCTCGAGATTGTGAAGAAGTTTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029633
VALIDATED
CLASP2 MISSION shRNA shRNA Plasmid DNA
cytoplasmic linker associated protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-2734s21c1
Sequence:CCGGGCTACTAAACTTCTTCACAATCTCGAGATTGTGAAGAAGTTTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-635s21c1
Sequence:CCGGGCATCACTGTTGCTCACCTTTCTCGAGAAAGGTGAGCAACAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-424s21c1
Sequence:CCGGGAACTTGAAGAGACGTTAAATCTCGAGATTTAACGTCTCTTCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-535s21c1
Sequence:CCGGGCCGCACAGTATGATTGCTTTCTCGAGAAAGCAATCATACTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-2021s1c1
Sequence:CCGGCGTGTTCAGAACGCTCCTATACTCGAGTATAGGAGCGTTCTGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-535s1c1
Sequence:CCGGGCCGCACAGTATGATTGCTTTCTCGAGAAAGCAATCATACTGTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-635s1c1
Sequence:CCGGGCATCACTGTTGCTCACCTTTCTCGAGAAAGGTGAGCAACAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029633.1-424s1c1
Sequence:CCGGGAACTTGAAGAGACGTTAAATCTCGAGATTTAACGTCTCTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-2734s1c1
Sequence:CCGGGCTACTAAACTTCTTCACAATCTCGAGATTGTGAAGAAGTTTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029633
VALIDATED
CLASP2 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic linker associated protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-2734s21c1
Sequence:CCGGGCTACTAAACTTCTTCACAATCTCGAGATTGTGAAGAAGTTTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-635s21c1
Sequence:CCGGGCATCACTGTTGCTCACCTTTCTCGAGAAAGGTGAGCAACAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-424s21c1
Sequence:CCGGGAACTTGAAGAGACGTTAAATCTCGAGATTTAACGTCTCTTCAAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029633.2-535s21c1
Sequence:CCGGGCCGCACAGTATGATTGCTTTCTCGAGAAAGCAATCATACTGTGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184683    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-2021s1c1
Sequence:CCGGCGTGTTCAGAACGCTCCTATACTCGAGTATAGGAGCGTTCTGAACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184224    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-535s1c1
Sequence:CCGGGCCGCACAGTATGATTGCTTTCTCGAGAAAGCAATCATACTGTGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-635s1c1
Sequence:CCGGGCATCACTGTTGCTCACCTTTCTCGAGAAAGGTGAGCAACAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029633.1-424s1c1
Sequence:CCGGGAACTTGAAGAGACGTTAAATCTCGAGATTTAACGTCTCTTCAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029633.1-2734s1c1
Sequence:CCGGGCTACTAAACTTCTTCACAATCTCGAGATTGTGAAGAAGTTTAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015097
VALIDATED
CLASP2 MISSION shRNA Bacterial Glycerol Stock
cytoplasmic linker associated protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000300965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015097.1-5179s21c1
Sequence:CCGGGCCAGTGTTATGATTGTATAACTCGAGTTATACAATCATAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015097.1-1810s21c1
Sequence:CCGGGCCGTCTTGGTTGAAACTATTCTCGAGAATAGTTTCAACCAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015097.1-1684s21c1
Sequence:CCGGCCCAGACTTATACCTTTAATACTCGAGTATTAAAGGTATAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015097.1-4135s21c1
Sequence:CCGGCCTGACGATCTTTCCCTAGATCTCGAGATCTAGGGAAAGATCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-5179s1c1
Sequence:CCGGGCCAGTGTTATGATTGTATAACTCGAGTTATACAATCATAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-1810s1c1
Sequence:CCGGGCCGTCTTGGTTGAAACTATTCTCGAGAATAGTTTCAACCAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-4135s1c1
Sequence:CCGGCCTGACGATCTTTCCCTAGATCTCGAGATCTAGGGAAAGATCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-1684s1c1
Sequence:CCGGCCCAGACTTATACCTTTAATACTCGAGTATTAAAGGTATAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-4656s1c1
Sequence:CCGGGCCAGGTCTAATACAGGGTTACTCGAGTAACCCTGTATTAGACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015097
VALIDATED
CLASP2 MISSION shRNA shRNA Plasmid DNA
cytoplasmic linker associated protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000300965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015097.1-5179s21c1
Sequence:CCGGGCCAGTGTTATGATTGTATAACTCGAGTTATACAATCATAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015097.1-1810s21c1
Sequence:CCGGGCCGTCTTGGTTGAAACTATTCTCGAGAATAGTTTCAACCAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015097.1-1684s21c1
Sequence:CCGGCCCAGACTTATACCTTTAATACTCGAGTATTAAAGGTATAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015097.1-4135s21c1
Sequence:CCGGCCTGACGATCTTTCCCTAGATCTCGAGATCTAGGGAAAGATCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-5179s1c1
Sequence:CCGGGCCAGTGTTATGATTGTATAACTCGAGTTATACAATCATAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-1810s1c1
Sequence:CCGGGCCGTCTTGGTTGAAACTATTCTCGAGAATAGTTTCAACCAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-4135s1c1
Sequence:CCGGCCTGACGATCTTTCCCTAGATCTCGAGATCTAGGGAAAGATCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-1684s1c1
Sequence:CCGGCCCAGACTTATACCTTTAATACTCGAGTATTAAAGGTATAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-4656s1c1
Sequence:CCGGGCCAGGTCTAATACAGGGTTACTCGAGTAACCCTGTATTAGACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015097
VALIDATED
CLASP2 MISSION shRNA Lentiviral Transduction Particles
cytoplasmic linker associated protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000300965    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_015097.1-5179s21c1
Sequence:CCGGGCCAGTGTTATGATTGTATAACTCGAGTTATACAATCATAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015097.1-1810s21c1
Sequence:CCGGGCCGTCTTGGTTGAAACTATTCTCGAGAATAGTTTCAACCAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015097.1-1684s21c1
Sequence:CCGGCCCAGACTTATACCTTTAATACTCGAGTATTAAAGGTATAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_015097.1-4135s21c1
Sequence:CCGGCCTGACGATCTTTCCCTAGATCTCGAGATCTAGGGAAAGATCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108255    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-5179s1c1
Sequence:CCGGGCCAGTGTTATGATTGTATAACTCGAGTTATACAATCATAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-1810s1c1
Sequence:CCGGGCCGTCTTGGTTGAAACTATTCTCGAGAATAGTTTCAACCAAGACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-4135s1c1
Sequence:CCGGCCTGACGATCTTTCCCTAGATCTCGAGATCTAGGGAAAGATCGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-1684s1c1
Sequence:CCGGCCCAGACTTATACCTTTAATACTCGAGTATTAAAGGTATAAGTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108256    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_015097.1-4656s1c1
Sequence:CCGGGCCAGGTCTAATACAGGGTTACTCGAGTAACCCTGTATTAGACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks