EMAIL THIS PAGE TO A FRIEND

CLC

Charcot-Leyden crystal galectin

24 Gene Product Result for
Synonyms: GAL10 Gal-10 LGALS10 LGALS10A LPPL_HUMAN
Species: Human CLC(1178), Mouse Clc(12735), fruit fly Clc(40221)
UniProtKB ID: Q05315, Q0VDE3
Gene ID:
Human(1178) Summary: Lysophospholipases are enzymes that act on biological membranes to regulate the multifunctional lysophospholipids. The protein encoded by this gene is a lysophospholipase expressed in eosinophils and basophils. It hydrolyzes lysophosphatidylcholine to glycerophosphocholine and a free fatty acid. This protein may possess carbohydrate or IgE-binding activities. It is both structurally and functionally related to the galectin family of beta-galactoside binding proteins. It may be associated with inflammation and some myeloid leukemias. [provided by RefSeq, Jul 2008]
Mouse(12735) Charcot-Leyden crystal protein
fruit fly(40221) Clathrin light chain
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1371 Human CLC ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001828 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001828 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001828 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015271 MISSION® esiRNA esiRNA targeting human CLC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001828 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00151652 predicted 358
2 SASI_Hs01_00151653 predicted 395
3 SASI_Hs01_00151654 predicted 389
4 SASI_Hs01_00151656 predicted 218
5 SASI_Hs02_00332630 predicted 315
6 SASI_Hs01_00151657 predicted 396
7 SASI_Hs01_00151658 predicted 310
8 SASI_Hs01_00151659 predicted 397
9 SASI_Hs01_00151660 predicted 201
10 SASI_Hs01_00151661 predicted 398
11 SASI_Hs01_00151655 predicted 369
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001828
CLC MISSION shRNA Bacterial Glycerol Stock
Charcot-Leyden crystal galectin
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-239s21c1
Sequence:CCGGCAAGTGTGCTTTGGTCGTCGTCTCGAGACGACGACCAAAGCACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-305s21c1
Sequence:CCGGGAATCCAAGAATATGCCCTTTCTCGAGAAAGGGCATATTCTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-424s21c1
Sequence:CCGGCAAGCCTGAGGCTGTGAAGATCTCGAGATCTTCACAGCCTCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-327s21c1
Sequence:CCGGAGGATGGCCAAGAATTTGAACCTCGAGGTTCAAATTCTTGGCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-212s21c1
Sequence:CCGGGAGGAATCAGACATTGTCTTCCTCGAGGAAGACAATGTCTGATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-364s1c1
Sequence:CCGGGCCAGATAAGTACCAGGTAATCTCGAGATTACCTGGTACTTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-468s1c1
Sequence:CCGGCCCTGACCAAATTTAATGTCACTCGAGTGACATTAAATTTGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-159s1c1
Sequence:CCGGCCTGTTTCTTGAATGAACCATCTCGAGATGGTTCATTCAAGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-402s1c1
Sequence:CCGGCTTACACCTTTGACCATAGAACTCGAGTTCTATGGTCAAAGGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-120s1c1
Sequence:CCGGCTACTGGTTCTACTGTGACAACTCGAGTTGTCACAGTAGAACCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001828
CLC MISSION shRNA shRNA Plasmid DNA
Charcot-Leyden crystal galectin
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-239s21c1
Sequence:CCGGCAAGTGTGCTTTGGTCGTCGTCTCGAGACGACGACCAAAGCACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-305s21c1
Sequence:CCGGGAATCCAAGAATATGCCCTTTCTCGAGAAAGGGCATATTCTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-424s21c1
Sequence:CCGGCAAGCCTGAGGCTGTGAAGATCTCGAGATCTTCACAGCCTCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-327s21c1
Sequence:CCGGAGGATGGCCAAGAATTTGAACCTCGAGGTTCAAATTCTTGGCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-212s21c1
Sequence:CCGGGAGGAATCAGACATTGTCTTCCTCGAGGAAGACAATGTCTGATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-364s1c1
Sequence:CCGGGCCAGATAAGTACCAGGTAATCTCGAGATTACCTGGTACTTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-468s1c1
Sequence:CCGGCCCTGACCAAATTTAATGTCACTCGAGTGACATTAAATTTGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-159s1c1
Sequence:CCGGCCTGTTTCTTGAATGAACCATCTCGAGATGGTTCATTCAAGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-402s1c1
Sequence:CCGGCTTACACCTTTGACCATAGAACTCGAGTTCTATGGTCAAAGGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-120s1c1
Sequence:CCGGCTACTGGTTCTACTGTGACAACTCGAGTTGTCACAGTAGAACCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001828
CLC MISSION shRNA Lentiviral Transduction Particles
Charcot-Leyden crystal galectin
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438428    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-239s21c1
Sequence:CCGGCAAGTGTGCTTTGGTCGTCGTCTCGAGACGACGACCAAAGCACACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-305s21c1
Sequence:CCGGGAATCCAAGAATATGCCCTTTCTCGAGAAAGGGCATATTCTTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-424s21c1
Sequence:CCGGCAAGCCTGAGGCTGTGAAGATCTCGAGATCTTCACAGCCTCAGGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-327s21c1
Sequence:CCGGAGGATGGCCAAGAATTTGAACCTCGAGGTTCAAATTCTTGGCCATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001828.4-212s21c1
Sequence:CCGGGAGGAATCAGACATTGTCTTCCTCGAGGAAGACAATGTCTGATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-364s1c1
Sequence:CCGGGCCAGATAAGTACCAGGTAATCTCGAGATTACCTGGTACTTATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-468s1c1
Sequence:CCGGCCCTGACCAAATTTAATGTCACTCGAGTGACATTAAATTTGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-159s1c1
Sequence:CCGGCCTGTTTCTTGAATGAACCATCTCGAGATGGTTCATTCAAGAAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-402s1c1
Sequence:CCGGCTTACACCTTTGACCATAGAACTCGAGTTCTATGGTCAAAGGTGTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001828.4-120s1c1
Sequence:CCGGCTACTGGTTCTACTGTGACAACTCGAGTTGTCACAGTAGAACCAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks