EMAIL THIS PAGE TO A FRIEND

CLCA1

chloride channel accessory 1

Synonyms: CACC CACC1 CLCRG1 CaCC-1 GOB5 hCLCA1 hCaCC-1
UniProtKB ID: A8K7I4, B2RAV5, O95151, Q5TDF4, Q9UNF6, Q9UPC6
Gene ID:
Human(1179) Summary: This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
Mouse(12722) chloride channel calcium activated 1
Rat(308015) chloride channel accessory 1
sheep(101115328) chloride channel accessory 1
naked mole-rat(101708961) chloride channel accessory 1
domestic guinea pig(100734482) chloride channel accessory 1
Zebrafish(334289) chloride channel accessory 1
domestic cat(101101241) chloride channel accessory 1
Horse(100009706) chloride channel accessory 1
cow(507643) chloride channel accessory 1
dog(490178) chloride channel accessory 1
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001285 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009899 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009899 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009899 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001285 Rosetta Predictions human pricing
NM_001107449 Rosetta Predictions rat pricing
NM_009899 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331531 predicted 1918
2 SASI_Hs01_00187984 predicted 1367
3 SASI_Hs02_00331532 predicted 530
4 SASI_Hs02_00331533 predicted 1622
5 SASI_Hs01_00187985 predicted 454
6 SASI_Hs01_00187986 predicted 2646
7 SASI_Hs01_00187987 predicted 1824
8 SASI_Hs01_00187988 predicted 2031
9 SASI_Hs01_00187989 predicted 2661
10 SASI_Hs01_00187990 predicted 1100
11 SASI_Hs01_00187981 predicted 2999
12 SASI_Hs01_00187982 predicted 2030
13 SASI_Hs01_00187983 predicted 2751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228935 predicted 2114
2 SASI_Rn02_00228936 predicted 1575
3 SASI_Rn02_00228937 predicted 446
4 SASI_Rn02_00228938 predicted 2395
5 SASI_Rn02_00228939 predicted 1157
6 SASI_Rn02_00228940 predicted 1933
7 SASI_Rn02_00228941 predicted 583
8 SASI_Rn02_00228942 predicted 585
9 SASI_Rn02_00228943 predicted 531
10 SASI_Rn02_00228944 predicted 2100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009899 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123802 predicted 2764
2 SASI_Mm01_00123803 predicted 2760
3 SASI_Mm01_00123804 predicted 1424
4 SASI_Mm01_00123805 predicted 1408
5 SASI_Mm01_00123806 predicted 2750
6 SASI_Mm02_00317401 predicted 2781
7 SASI_Mm02_00317402 predicted 2365
8 SASI_Mm01_00123807 predicted 2783
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001285
CLCA1 MISSION shRNA Bacterial Glycerol Stock
chloride channel accessory 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000044883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-2233s1c1
Sequence:CCGGGCCCTGATTGAATCAGTGAATCTCGAGATTCACTGATTCAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-1069s1c1
Sequence:CCGGGCACAACATGTTGATTCTATACTCGAGTATAGAATCAACATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-852s1c1
Sequence:CCGGCGAGTACAATAATGATGAGAACTCGAGTTCTCATCATTATTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-2929s1c1
Sequence:CCGGGCACGAGTATCTTTGTTTATTCTCGAGAATAAACAAAGATACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000044885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-406s1c1
Sequence:CCGGGCCCTGAGTAATTCACTCATTCTCGAGAATGAGTGAATTACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001285.3-703s21c1
Sequence:CCGGACTGGTACAAATGTAGTAAAGCTCGAGCTTTACTACATTTGTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001285.3-2487s21c1
Sequence:CCGGCAAGTATATCATTCGAATAAGCTCGAGCTTATTCGAATGATATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001285
CLCA1 MISSION shRNA shRNA Plasmid DNA
chloride channel accessory 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000044883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-2233s1c1
Sequence:CCGGGCCCTGATTGAATCAGTGAATCTCGAGATTCACTGATTCAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-1069s1c1
Sequence:CCGGGCACAACATGTTGATTCTATACTCGAGTATAGAATCAACATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-852s1c1
Sequence:CCGGCGAGTACAATAATGATGAGAACTCGAGTTCTCATCATTATTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-2929s1c1
Sequence:CCGGGCACGAGTATCTTTGTTTATTCTCGAGAATAAACAAAGATACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000044885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-406s1c1
Sequence:CCGGGCCCTGAGTAATTCACTCATTCTCGAGAATGAGTGAATTACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001285.3-703s21c1
Sequence:CCGGACTGGTACAAATGTAGTAAAGCTCGAGCTTTACTACATTTGTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001285.3-2487s21c1
Sequence:CCGGCAAGTATATCATTCGAATAAGCTCGAGCTTATTCGAATGATATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001285
CLCA1 MISSION shRNA Lentiviral Transduction Particles
chloride channel accessory 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000044883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-2233s1c1
Sequence:CCGGGCCCTGATTGAATCAGTGAATCTCGAGATTCACTGATTCAATCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-1069s1c1
Sequence:CCGGGCACAACATGTTGATTCTATACTCGAGTATAGAATCAACATGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-852s1c1
Sequence:CCGGCGAGTACAATAATGATGAGAACTCGAGTTCTCATCATTATTGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-2929s1c1
Sequence:CCGGGCACGAGTATCTTTGTTTATTCTCGAGAATAAACAAAGATACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000044885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001285.1-406s1c1
Sequence:CCGGGCCCTGAGTAATTCACTCATTCTCGAGAATGAGTGAATTACTCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427582    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001285.3-703s21c1
Sequence:CCGGACTGGTACAAATGTAGTAAAGCTCGAGCTTTACTACATTTGTACCAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001285.3-2487s21c1
Sequence:CCGGCAAGTATATCATTCGAATAAGCTCGAGCTTATTCGAATGATATACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009899
CLCA1 MISSION shRNA Bacterial Glycerol Stock
chloride channel accessory 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000069328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-2313s1c1
Sequence:CCGGGCTGAGTTTATAGGTGATTATCTCGAGATAATCACCTATAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-720s1c1
Sequence:CCGGGCCTCCATAATGTTCATGCAACTCGAGTTGCATGAACATTATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-165s1c1
Sequence:CCGGCCAAGCATAAAGGAAATGGTACTCGAGTACCATTTCCTTTATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-1518s1c1
Sequence:CCGGGCATGGATAAACGGTACAGTACTCGAGTACTGTACCGTTTATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000069330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-1914s1c1
Sequence:CCGGGCCCTCATAGAAGCTGAACATCTCGAGATGTTCAGCTTCTATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009899
CLCA1 MISSION shRNA shRNA Plasmid DNA
chloride channel accessory 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000069328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-2313s1c1
Sequence:CCGGGCTGAGTTTATAGGTGATTATCTCGAGATAATCACCTATAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-720s1c1
Sequence:CCGGGCCTCCATAATGTTCATGCAACTCGAGTTGCATGAACATTATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-165s1c1
Sequence:CCGGCCAAGCATAAAGGAAATGGTACTCGAGTACCATTTCCTTTATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-1518s1c1
Sequence:CCGGGCATGGATAAACGGTACAGTACTCGAGTACTGTACCGTTTATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000069330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-1914s1c1
Sequence:CCGGGCCCTCATAGAAGCTGAACATCTCGAGATGTTCAGCTTCTATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009899
CLCA1 MISSION shRNA Lentiviral Transduction Particles
chloride channel accessory 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000069328    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-2313s1c1
Sequence:CCGGGCTGAGTTTATAGGTGATTATCTCGAGATAATCACCTATAAACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-720s1c1
Sequence:CCGGGCCTCCATAATGTTCATGCAACTCGAGTTGCATGAACATTATGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-165s1c1
Sequence:CCGGCCAAGCATAAAGGAAATGGTACTCGAGTACCATTTCCTTTATGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-1518s1c1
Sequence:CCGGGCATGGATAAACGGTACAGTACTCGAGTACTGTACCGTTTATCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000069330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009899.2-1914s1c1
Sequence:CCGGGCCCTCATAGAAGCTGAACATCTCGAGATGTTCAGCTTCTATGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks